Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 

Title:  Recombinant Sef14 fimbrial protein from Salmonella

United States Patent:  6,495,334

Issued:  December 17, 2002

Inventors:  Rajashekara; Gireesh (St. Paul, MN); Nagaraja; Kakambi V. (Roseville, MN); Kapur; Vivek (St. Anthony, MN)

Assignee:  Regents of the University of Minnesota (Minneapolis, MN)

Appl. No.:  230078

Filed:  May 20, 1999

PCT Filed:  January 29, 1998

PCT NO:  PCT/US97/12639

371 Date:  July 18, 1997

Abstract

A truncated SE fimbria antigen useful as an antigen for immunoassay diagnosis of Salmonella enteritidis (SE) infection or evidence of infection.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is directed to a method for diagnosing Salmonella enteritidis infection or evidence of infection in an animal, particularly poultry, using a recombinant truncated fimbrial antigen.

"Infection" means active colonization of the animal by SE organisms. "Evidence of infection" means a prior history of colonization by SE in the animal, although active colonization is not present. Diagnosis of active infection is needed to protect against contamination of food supplies, whereas diagnosis of prior infection is needed to alert against new infection or to trace the source of infection in a flock.

Fimbrial Proteins

Fimbriae are proteinaceous filamentous surface structures composed of protein subunits called fimbrin. These proteinaceous structures are thought to be virulence factors which mediate specific attachment to host cell mucosal surfaces. They are present in most enteric bacteria capable of invading host cells.

Salmonella enteritidis has four distinct fimbriae: Sef14, Sef17, Sef18 and Sef21 which are encoded by sefA, agfA, sefD and fimA genes, respectively. Sef14, is unique with only limited distribution in the genus. In contrast, all other fimbrial proteins are widely distributed in the genus. Thus, they have limited use as diagnostic reagents for SE detection.

Cloning and Expression of Sef14,

In the present invention, a truncated form of the Sef14 antigen retaining the antigenic character of the entire protein has been produced. Unlike the complete protein, however, the truncated form can be easily produced in purified form and in large quantities, without special growth medium requirements.

PCR technology is used to produce the truncated Sef14 protein by amplification with suitable primers.

Primers are selected to amplify the gene encoding Sef14 in a region downstream of the encoded signal peptide, e.g., downstream of about nucleotide 145 of the DraI genomic fragment shown in FIG. 1 of Turcotte and Woodward, Supra. Preferably, the PCR primers include, additional nucleotides at the 5' ends, specific restriction enzyme recognition sequences, for ease of purification. For example, useful primers for amplifying that portion of the sefA gene encoding an immunogenic Sef14 fragment downstream of the signal peptide are shown below:

 

        GGGAATTCGCTGGCTTTGTTGGTAACA           SEQ ID NO:1
        GGGCTCGAGTTAGTTTTGATACTGAACGTA        SEQ ID NO:2



After a truncated gene sequence encoding Sef14 is produced, it can be cloned into a host using a plasmid or phage as a vector. Typically, the expression of Sef14 fimbriae by cultured Salmonella enteritidis is highly dependent on the growth medium composition (Thorns et al, International Journal of Food Microbiology, 21:47-53 (1994)), and it is typically difficult to produce large quantities. However, a truncated form of Sef14 having at least the signal peptide removed is expressed in host systems such as E. coli without these difficulties.

Truncated Sef14 Antigen

Because the truncated Sef14 protein retains the antigenic characteristics of the complete protein, it is useful in various immunological methods. For example, the inventive antigen is useful in antibody binding immunoassays such as assays to detect the presence of antibodies against SE in a sample. Suitable binding assays include ELISA, wherein the recombinant Sef14 antigen is bound to a surface and exposed to antibodies against SE. To detect the presence of bound anti-SE antibodies, a marker such as an enzyme-linked secondary antibody is then added.

An agglutination assay using truncated Sef14 antigen-coated latex beads is preferred. In the agglutination reaction, antigen-coated latex beads form detectable clusters when exposed to antibodies against SE. This preferred assay is described more fully in Example 4, below.

Diagnostic Assays

The assays described above can be used to detect the presence of antibodies to Salmonella enteritidis. Preferably, the assays are used to determine whether or not an animal, e.g. a poultry animal such as a chicken or turkey, is infected with SE. Animal fluid such as blood or serum can be used in a diagnostic assay. If an animal is infected with SE, the animal will typically produce anti-SE antibodies. The recombinant Sef14 antigen is used to detect the presence of anti-SE antibodies, SE infection or the SE organism itself. Diagnostic assays such as these are particularly useful in birds. More particularly, diagnostic assays are useful in detecting SE infections in chicken or turkey to prevent foodborne illness by poultry consumption.

Vaccine

Passive immunization with anti-Sef14 antibodies has been shown to reduce Salmonella enteritidis colonization (Peralta et al. 1994). Additionally, Sef14 can induce a T-cell immune response (Ogunniyi et al 1994). Because the truncated Sef14 antigen exhibits these immunological activities, can be produced in large quantities, and does not have the cumbersome growth requirements of the complete protein, the truncated Sef14 antigen is also useful as a vaccine to confer immunity against SE. Preferably, the truncated Sef14 antigen is used as a vaccine in poultry to prevent foodborne illnesses.

Claim 1 of 13 Claims

We claim:

1. A method for detecting anti-Salmonella enteritidis antibodies in animals, the method comprising:

reacting a sample obtained from an animal with a truncated Sef14 antigen under conditions to permit anti-Salmonella enteritidis antibodies to bind the antigen, the truncated antigen having at least the native Sef14 signal peptide removed;

determining the presence or amount of antibody-antigen binding; and

correlating antibody-antigen binding with the presence of anti-Salmonella enteritidis antibodies in the sample.
 


____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]