|
|

Title: Recombinant Sef14 fimbrial protein from
Salmonella
United States Patent: 6,495,334
Issued: December 17, 2002
Inventors: Rajashekara; Gireesh (St. Paul, MN); Nagaraja;
Kakambi V. (Roseville, MN); Kapur; Vivek (St. Anthony, MN)
Assignee: Regents of the University of Minnesota
(Minneapolis, MN)
Appl. No.: 230078
Filed: May 20, 1999
PCT Filed: January 29, 1998
PCT NO: PCT/US97/12639
371 Date: July 18, 1997
Abstract
A truncated SE fimbria antigen useful as an antigen for immunoassay
diagnosis of Salmonella enteritidis (SE) infection or evidence of infection.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to a method for diagnosing Salmonella
enteritidis infection or evidence of infection in an animal, particularly
poultry, using a recombinant truncated fimbrial antigen.
"Infection" means active colonization of the animal by SE organisms.
"Evidence of infection" means a prior history of colonization by SE in the
animal, although active colonization is not present. Diagnosis of active
infection is needed to protect against contamination of food supplies,
whereas diagnosis of prior infection is needed to alert against new
infection or to trace the source of infection in a flock.
Fimbrial Proteins
Fimbriae are proteinaceous filamentous surface structures composed of
protein subunits called fimbrin. These proteinaceous structures are thought
to be virulence factors which mediate specific attachment to host cell
mucosal surfaces. They are present in most enteric bacteria capable of
invading host cells.
Salmonella enteritidis has four distinct fimbriae: Sef14, Sef17, Sef18 and
Sef21 which are encoded by sefA, agfA, sefD and fimA genes, respectively.
Sef14, is unique with only limited distribution in the genus. In contrast,
all other fimbrial proteins are widely distributed in the genus. Thus, they
have limited use as diagnostic reagents for SE detection.
Cloning and Expression of Sef14,
In the present invention, a truncated form of the Sef14 antigen retaining
the antigenic character of the entire protein has been produced. Unlike the
complete protein, however, the truncated form can be easily produced in
purified form and in large quantities, without special growth medium
requirements.
PCR technology is used to produce the truncated Sef14 protein by
amplification with suitable primers.
Primers are selected to amplify the gene encoding Sef14 in a region
downstream of the encoded signal peptide, e.g., downstream of about
nucleotide 145 of the DraI genomic fragment shown in FIG. 1 of Turcotte and
Woodward, Supra. Preferably, the PCR primers include, additional nucleotides
at the 5' ends, specific restriction enzyme recognition sequences, for ease
of purification. For example, useful primers for amplifying that portion of
the sefA gene encoding an immunogenic Sef14 fragment downstream of the
signal peptide are shown below:
GGGAATTCGCTGGCTTTGTTGGTAACA SEQ ID NO:1
GGGCTCGAGTTAGTTTTGATACTGAACGTA SEQ ID NO:2
After a truncated gene sequence encoding Sef14 is produced, it can be cloned
into a host using a plasmid or phage as a vector. Typically, the expression
of Sef14 fimbriae by cultured Salmonella enteritidis is highly dependent on
the growth medium composition (Thorns et al, International Journal of Food
Microbiology, 21:47-53 (1994)), and it is typically difficult to produce
large quantities. However, a truncated form of Sef14 having at least the
signal peptide removed is expressed in host systems such as E. coli without
these difficulties.
Truncated Sef14 Antigen
Because the truncated Sef14 protein retains the antigenic characteristics of
the complete protein, it is useful in various immunological methods. For
example, the inventive antigen is useful in antibody binding immunoassays
such as assays to detect the presence of antibodies against SE in a sample.
Suitable binding assays include ELISA, wherein the recombinant Sef14 antigen
is bound to a surface and exposed to antibodies against SE. To detect the
presence of bound anti-SE antibodies, a marker such as an enzyme-linked
secondary antibody is then added.
An agglutination assay using truncated Sef14 antigen-coated latex beads is
preferred. In the agglutination reaction, antigen-coated latex beads form
detectable clusters when exposed to antibodies against SE. This preferred
assay is described more fully in Example 4, below.
Diagnostic Assays
The assays described above can be used to detect the presence of antibodies
to Salmonella enteritidis. Preferably, the assays are used to determine
whether or not an animal, e.g. a poultry animal such as a chicken or turkey,
is infected with SE. Animal fluid such as blood or serum can be used in a
diagnostic assay. If an animal is infected with SE, the animal will
typically produce anti-SE antibodies. The recombinant Sef14 antigen is used
to detect the presence of anti-SE antibodies, SE infection or the SE
organism itself. Diagnostic assays such as these are particularly useful in
birds. More particularly, diagnostic assays are useful in detecting SE
infections in chicken or turkey to prevent foodborne illness by poultry
consumption.
Vaccine
Passive immunization with anti-Sef14 antibodies has been shown to reduce
Salmonella enteritidis colonization (Peralta et al. 1994). Additionally,
Sef14 can induce a T-cell immune response (Ogunniyi et al 1994). Because the
truncated Sef14 antigen exhibits these immunological activities, can be
produced in large quantities, and does not have the cumbersome growth
requirements of the complete protein, the truncated Sef14 antigen is also
useful as a vaccine to confer immunity against SE. Preferably, the truncated
Sef14 antigen is used as a vaccine in poultry to prevent foodborne
illnesses.
Claim 1 of 13 Claims
We claim:
1. A method for detecting anti-Salmonella enteritidis antibodies in animals,
the method comprising:
reacting a sample obtained from an animal with a truncated Sef14 antigen
under conditions to permit anti-Salmonella enteritidis antibodies to bind
the antigen, the truncated antigen having at least the native Sef14 signal
peptide removed;
determining the presence or amount of antibody-antigen binding; and
correlating antibody-antigen binding with the presence of anti-Salmonella
enteritidis antibodies in the sample.
____________________________________________
If you want to learn more
about this patent, please go directly to the U.S.
Patent and Trademark Office Web site to access the full
patent.
|