|
|

Title: Transposition assembly for gene transfer in
eukaryotes
United States Patent: 6,346,414
Inventors: Jacobs; Eric (Dorlisheim, FR)
Assignee: Transgene S.A. (Strasbourg, FR)
Appl. No.: 532657
Filed: October 16, 1995
PCT Filed: April 14, 1994
PCT NO: PCT/FR94/00419
371 Date: October 16, 1995
102(e) Date: October 16, 1995
PCT PUB.NO.: WO94/24300
PCT PUB. Date: October 27, 1994
Foreign Application Priority Data: Apr 16, 1993[FR] (93
04530)
Abstract
A transposition assembly for the transfer of a DNA fragment of interest
into the ribosomal nuclear DNA of an eukaryotic cell. An insertion means,
an eukaryotic cell and a pharmaceutical composition comprising said
transposition assembly, as well as a method for the in vitro transfer of
said DNA fragment, are also disclosed.
Description of the Invention
The present invention relates to a transposition assembly
allowing the transfer of genes of interest into the genome of a cell or of
a eukaryotic organism. Such an assembly is particularly useful for gene
therapy purposes.
Numerous elements which can be employed by the integration of genes of
interest into the eukaryotic genome have been described in the prior art
publications. The conventional elements are either integrative vectors,
for example retroviral vectors, or nonintegrative vectors, for example
adenoviral vectors. However, these prior art vectors not only have
advantages.
In fact, the retroviral vectors are integrated randomly into the cellular
genome in a nonspecific manner. Thus the risk of insertional mutagenesis
linked either to the inactivation of genes essential to the cell, or to
the activation of oncogenes, which can give rise to a tumoral
proliferation, is not to be neglected before contemplating their use in
human gene therapy.
As far as the nonintegrative vectors are concerned, they have
disadvantages linked to an instability on account of their nonintegration
into the cellular genome, which necessitates their regularly repeated
administration. Within the context of a gene therapy intended for man, in
the long term this risks posing problems of immunization against the
recombinant virus in regularly treated patients.
A third type of method, described more recently, allows the transfer of
genes of interest by homologous recombination into a defined site of the
cellular genome. However, the technique of homologous recombination again
comes up against numerous technical difficulties. In addition,
nonhomologous recombination events can equally be produced, so that the
risk of insertional mutagenesis remains.
Moreover, the prior art has for a long time established the scheme of
organization and of expression of ribosomal DNA (rDNA) in eukaryotes
(Reeder, Trends Genet. 1990, 6, 390-395). Generally speaking, rDNA is
formed by multiple copies of transcription units arranged in pairs. A
transcriptional unit is composed of genes coding respectively for the 18S
or 16S, 5-8S and 28S or 26S rRNAs, which enter into the constitution of
the ribosome (below designated 18S rRNA gene etc.). Each gene is separated
from the following by transcribed sequences whose exact role is still not
defined. The three rRNA genes contained in a transcriptional unit are
placed under the control of a unique promoter situated upstream in the
nontranscribed region which separates one unit from the following. The
units of rRNA are transcribed by the RNA polymerase I in a long molecule
of precursor rRNA (pre-rRNA), which is then matured to produce the three
principle types of rRNA associated to the ribosomal sub-units.
Numerous publications have reported the frequent presence of foreign
genetic elements in the rDNA of eukaryotes. Among these genetic elements,
introns of class I or II and retroposons, for example of class R1, R2 or
R3, can be mentioned. The presence of these foreign elements can possibly
inactivate a fraction of the transcriptional units of the rDNA. This does
not seem to have serious consequences for the life of the organisms
containing them. This phenomenon has particularly been described in the
drosophila.
The introns of classes I and II are defined by the existence of preserved
sequences forming structural elements characteristic of each of the
classes such as defined by Cech and Bass (1986, Annu. Rev. Biochem 55,
599-629). Several authors have observed that certain introns of classes I
and II are mobile. They can be copied and transferred specifically into
copies of genes which are devoid of them (intron-). This
transposition process, at least in the majority of cases, turns out to be
specific from the point of view of the insertion region.
Among the sixty or so introns of class I characterized until now, the
majority are localized in the genes of the mitochondria and of the
chloroplasts. The prior art mentions, in three cases only, the presence of
mobile introns of class I in the nuclear genes. These introns have been
demonstrated at the level of the rRNA genes of three species of lower
eukaryotes, respectively the 26S rRNA genes of several strains of
Tetrahymena (Kan et Gall, 1982, Nucl. Acids Res., 10, 2809-2821) and of
the Carolina strain of Physarum polycephalum, (Muscarella et Vogt, 1989,
Cell, 56, 443-454; this mobile intron being designated intron 3 below) and
finally in the 16S rRNA gene of Pneumocystis carinii (Edman et al., 1988,
Nature 334, 519-522). Until now, it has not been possible to demonstrate
the presence of introns interrupting the rRNA genes of higher eukaryotes.
The intron 3 of Physarum polycephalum is the best characterized. Its
mobility has been demonstrated experimentally (Muscarella et Vogt, 1989,
Cell, 56, 443-454). This intron codes in part for a protein of 160 amino
acids (Muscarella et al., 1990, Mol. Cel. Biol., 10, 3386-3396). The
initiation codon of the putative translation is situated upstream of the
intron, at the 3' end of the adjacent exon sequence at the 5' end of the
intron. The protein encoded by the intron 3 is an endonuclease which
recognizes a target sequence of at least 18 base pairs (bp) present in the
insertion region and is capable of cleaving this sequence exactly at the
level of the site of insertion of the intron 3 (Muscarella et Vogt, 1989,
Cell, 56, 443-454).
The target sequence recognized by the endonuclease comprises the following
sequence: 5' CTATGACTCTCTTAAGGTAGCCAAA3' (SEQ ID NO:1). It is assumed that
the transposition of the intron 3 is initiated by the recognition of the
particular target sequence by the endonuclease specifically encoded by the
intron 3, followed by a cutting of the two strands of the DNA molecule at
the level of this particular sequence, thus liberating the insertion site.
Then, by an exchange of fibers involving the flanking sequences at the 5'
and 3' ends of the insertion site, copying of the intron sequence and
recombination, the intron 3 is inserted into the copy of the intron-
rRNA gene in a precise and site-specific manner. Once the intron 3 is
inserted into a copy of the intron- gene, the target sequence
recognized by the endonuclease is interrupted by the intron sequence in
the following manner: 5' CTATGACTCTCT (SEQ ID NO:2) intron 3
TAAGGTAGCCAAA3' (SEQ ID NO:3).
On the other hand, retroposons equally seem to be present in the rDNA of
certain eukaryotes. Generally speaking the retroposons form a very huge
and very heterogeneous group, especially at the level of their nucleotide
sequence. Retroposon is understood as meaning elements related to the
retroviruses, but devoid of long terminal repeats (LTR). They comprise one
or more open reading frames capable of coding for proteins having a
homology with retroviral proteins, such as, for example, reverse
transcriptase (Jakubczak et al., 1991, Proc. Natl. Acad. Sci. USA, 88,
3295-3299).
In a certain number of nonmammalian eukaryotes, especially insects,
retroposons having a remarkable specificity of insertion have been found,
localized at the level of the rRNA genes. The mobility of certain of these
has been observed. Several families (especially R1, R2 and R3) have been
defined as a function of their specific insertion region into the rRNA
genes.
The retroposons of the classes R1 and R2 are especially illustrated by the
retroposons R1Bm and R2Bm of Bombyx mori (Xiong and Eickbush, 1988, Cell,
55, 235-246; Xiong and Eickbush, 1988, Mol. Cell. Biol., 8, 114-123; Xiong
et al., 1988, Nucl. Ac. Res., 16, 10561-10573) and the retroposons R1Dm
and R2Dm of Drosophila melanogaster (Jakubczak et al., 1990, J. Mol.
Biol., 212, 37-52). They contain air open reading frame capable of coding
for a protein of great size whose central part has a homology with the
reverse transcriptase family. Xiong and Eickbush (1988, Cell, 55, 235-246)
report that the protein encoded by the retroposon R2Bm of Bombyx mori
moreover has an endonuclease activity. This nuclease recognizes and
cleaves a target sequence contained in the insertion region of R2Bm
situated in the 28S rRNA gene of the insect genome.
A novel class of ribosomal retroposons, designated R3, has recently been
demonstrated. Protein encoded by this element has still not been
characterized. However, the specific insertion region of the element R3
into the rDNA of Scaria coprophila has been described (Kerrebrock et al.,
J. Mol. Biol., 1989, 210, 1-13).
Beside retroposons, there are a large number of mobile genetic elements
which have sometimes been designated under the name of retroposons by the
authors describing them, but of which it has still not been shown that
they code for a protein having a homology with the family of retroviral
proteins, especially reverse transcriptase. This type of elements has
equally been found at the level of well-defined sequences of rRNA genes of
organisms containing them (see, for example, Back et al., 1984, EMBO J.,
3, 2523-2529).
Surprisingly, it has now been found that on the one hand the target
sequences recognized by the endonucleases encoded by the two mobile
genetic elements for which the data are available (intron 3 of Physarum
polycephalum and retroposon R2Bm of Bombyx mori) and on the other hand the
insertion regions of certain mobile genetic elements of which it has still
not been shown that they code for an endonuclease and which have been
disclosed in the prior art (Jakubczak et al., 1991, Proc. Natl. Acad. Sci.
USA, 88, 3295-3299; Paskwitz et Collins, 1989, Nucleic Acid Res. 17,
8125-8133; Kerrebrock et al., 1989, J. Mol. Biol., 210, 1-13; Kan and
Gall, 1982, Nucleic Acid Res., 10, 2809-2821; Edman et al., 1988, Nature,
263, 519-522), are conserved in the rRNA genes of various mammals,
especially man and the mouse. Thus, the sequences of insertion regions of
mobile introns of Tetrahymena, of Pneumocystis carinii and of Physarum
polycephalum, and of R2Bm retroposons of Bombyx mori, and R3 of Scaria
coprophila are conserved identically in the rRNA genes of mammals. On the
other hand, the sequences of the insertion region of the retroposons R1Dm
and R1Bm are homologous but nonidentical to a sequence present in the
mammalian 28S rRNA gene.
Consequently, the present invention relates to a transposition assembly
intended for the transfer of a DNA fragment of interest into the genome of
a eukaryotic host cell, which comprises an integration cassette,
essentially formed by a mobile genetic element in the midst of which is
inserted the said DNA fragment of interest; the said integration cassette
being capable of being integrated in a site-specific fashion into a
specific insertion site situated in the ribosomal nuclear DNA of the said
host cell.
A transposition assembly according to the invention has the advantage of
allowing the integration of a DNA fragment of interest into a defined and
nonessential region of the cellular genome. Such an assembly is especially
useful for gene therapy purposes.
For the purposes of the present invention, the integration cassette must
comprise a mobile genetic element which has the capacity for integrating
itself by a site-specific mechanism into the nuclear rDNA, in particular
at the level of the 28S, 18S or 5-8S rRNA gene. More precisely, this
mobile genetic element must integrate itself into an insertion site
situated in an insertion region of which the sequence is conserved in an
identical or nonidentical manner in the nuclear rDNA of the host cell.
For a better understanding, it is specified that the term "insertion
site" defines the place between 2 nucleotides where a mobile genetic
element is inserted. In the same way, "insertion region" is
understood as meaning the nucleotide sequences at the 5' and 3' end of the
insertion site which are required for the site-specific transposition.
Generally speaking, each mobile genetic element possesses an insertion
region which is specific to it. As mentioned above for the retroposons
R1Bm and R1dm, it is not required that the insertion region in the host
cell comprises in an identical manner the sequences of the natural
insertion region (in the organism of origin). Thus, the sequence of the
insertion region of the said mobile genetic element in the eukaryotic host
cell will present a degree of homology with the sequence of the natural
insertion region greater than 80%, advantageously greater than 90% and
preferably greater than 95%.
The mobile genetic element is advantageously selected from amongst mobile
introns of class I or II, and retroposons such as the retroposons of class
R1R2 [sic] or R3.
A genetic mobile element can be formed by a functional fragment or a
variant of the said element. Functional fragment is understood as meaning
any fragment which has conserved the capacity of being integrated of the
complete element. A variant can comprise one or more mutations with
respect to the natural nucleotide sequence of the element, especially the
substitution, addition or deletion of one or more nucleotides, on
condition that these mutations do not alter the function.
More particularly, the mobile genetic element is selected from amongst:
the intron 3 of Physarum polycephalum, Carolina strain, a fragment or a
variant of the said intron,
the mobile intron of class I of Tetrahymena, a fragment or a variant of
the said intron,
the mobile intron of class I of Pneumocystis carinii, a fragment or a
variant of the said intron,
the retroposon of R2Bm of Bombyx mori, a fragment or a variant of the said
retroposon and,
the retroposon R3 of Scaria coprophila, a fragment or a variant of the
said retroposon.
The presence in this mobile genetic element of all or part of an open
reading frame capable of coding for an integrase is a preferred
characteristic.
Generally speaking, integrase is understood as meaning a protein having an
enzymatic activity allowing it to participate directly or indirectly in
the trans-position of the mobile genetic element specifically at the level
of its insertion site in the nuclear rDNA of a eukaryotic cell.
Advantageously, the integrase can be especially formed by:
(1) a protein having an endonuclease activity capable of recognizing a
specific target sequence included in the insertion region of the mobile
genetic element which codes for it and of cleaving the said target
sequence, or
(2) a protein having a homology with the family of reverse transcriptases.
It is possible to mention, for example, the endonuclease encoded in part
by the intron 3 of Physarum popycephalum. This endonuclease initiates the
transposition of the intron 3 on recognizing its target sequence and
cleaving the DNA molecule at the level of this specific sequence.
It is equally possible to mention the protein encoded by the retroposon
R2Bm of Bombyx mori. The endonuclease activity of the said protein is
probably involved in the transposition of R2Bm at the level of its
specific insertion region, but by a mechanism which is not known to date.
The DNA fragment of interest can be introduced into the mobile genetic
element by the conventional techniques of genetic engineering. It can be
integrated in or outside of the open reading frame coding for a possible
integrase.
According to a particularly advantageous aspect of the invention, the DNA
fragment of interest is inserted in the open reading frame in order to
prevent the expression of the integrase. This introduces a security
feature to avoid the uncontrolled propagation of the integration cassette
in the genome of the host cell.
In this case, the specific integrase of the mobile genetic element
employed in the transposition assembly according to the invention should
be supplied to the host cell in a transitory manner during a time which is
sufficiently long to allow the transposition of the integration cassette
into its specific insertion region. The means of supplying a protein in
trans to a eukaryotic cell are numerous and known to the person skilled in
the art.
For example, the transposition assembly according to the invention can be
introduced into a vector (such as defined below), moreover comprising an
expression cassette of the specific integrase of the mobile genetic
element present in the transposition assembly.
In an alternative manner, the eukaryotic host cell can be transfected in
parallel with a helper vector comprising an expression cassette of the
integrase or the integrase can be supplied in purified form to the host
cell.
The DNA fragment of interest can be any fragment capable of being
transcribed to RNA to produce an anti-sense RNA for example a
complementary RNA sequence of a pathogenic gene capable of forming a
duplex with a pathogenic transcript in order to inhibit the translation to
pathogenic protein. A pathogenic gene is:
(1) a gene which is not present in the eukaryotic cells, for example a
gene present in the genome of a pathogenic organism (bacteria, virus or
parasite), or
(2) a homologous gene or a mutated homologous gene, for example an
oncogene, which is present but normally not expressed in the normal
eukaryotic cells and whose abnormally induced expression can cause a
disorder such as cancer.
In an alternative fashion, the DNA fragment of interest can code for a
protein of interest and, in a preferred manner, a protein whose absence of
expression or expression in abnormal quantity or in mutant form is
associated with a genetic disorder.
The DNA fragment of interest can code for a mature protein or a precursor
of this. In the first case, it comprises the sequence coding for a mature
protein allowing the expression of the protein in intracellular fashion.
In the last case, the DNA fragment of interest can equally include a
signal sequence allowing the secretion of the said protein of the host
cell. The DNA fragment of interest can code for a chimeric protein arising
from the fusion of various sequences of origin.
The examples of proteins which can be encoded by the DNA fragment of
interest comprise:
cytokines, such as alpha interferon, gamma interferon and different types
of growth factors,
membrane receptors, such as the receptors involved in the transmission of
signals from the surface to the interior of cells and the receptors
recognized by pathogenic organisms, such as the CD4 receptor present at
the surface of T lymphocytes and recognized by the envelope glyco-protein
of the HIV virus (Human Immunodeficiency Virus),
enzymes, such as the ribonucleases and the thymidine kinase (TK) of the
type I herpes simplex virus (HSV-1). The latter has a superior affinity
with respect to the mammalian cell TK enzyme for certain analogs of
nucleosides, such as acyclovir or gancyclovir. The enzyme TK-HSV-1
converts the analogs into precursors of nucleotides. These toxic
precursors are then incorporated into the DNA of cells in a state of
replication. This incorporation allows the cells in division, such as
cancer cells, to be killed specifically,
inhibitors of enzymatic activity, such as alpha 1 antitrypsin,
antithrombin III, protein C and specific protease inhibitors of a
pathogenic organism,
coagulation factors, such as factor VIII, factor IX and thrombin,
proteins involved in ionic channels, such as the protein CFTR (Cystic
Fibrosis Transmembrane Conductance Regulator),
proteins capable of inhibiting the activity of a protein produced by a
pathogenic gene, such as the suppressor antigen of tumor p53,
variants of pathogenic proteins mutated so as to alter their biological
function, such as trans-dominant mutants of the regulator protein TAT of
the HIV virus capable of competing with the native viral protein for
linkage to the target sequence, preventing activation of the expression of
the viral genes and,
antigenic epitopes allowing immunity of the host cell to be increased.
The DNA fragment of interest can be mutated so as to allow the expression
of a protein of interest whose biological properties are modified, for
example a variant of alpha 1 antitrypsin whose methionine residue in
position 358 of the active site has been replaced by a leucine. Such a
variant is functional under oxidation conditions such as inflammation
conditions.
Once the integration cassette is introduced into the rDNA of the host
cell, the DNA fragment of interest can be placed under the dependence of
the promoter of the transcriptional unit of the rDNA of the host cell.
Alternatively, the DNA fragment of interest can be placed under the
control of appropriate expression elements inserted into the mobile
genetic element. Expression here signifies transcription to RNA and/or
translation of this RNA to protein.
According to this alternative, the control elements of the expression
especially comprise an appropriate promoter. Such promoters are well known
to the person skilled in the art and are inserted upstream of the DNA
fragment of interest by the conventional techniques of genetic
engineering.
The promoter retained can be a promoter recognized by RNA polymerase I, so
as to favor the expression of the DNA fragment of interest, after
integration of the integration cassette into the rRNA genes of the
eukaryotic host cell. For example, the DNA fragment of interest can be
placed under the control of regulation elements included in the
nontranscribed regions of the rDNA involved in the transcription of the
rRNA genes. Such promoters will be chosen so as to be functional in the
eukaryotic host cell which has been retained.
In an alternative manner, the promoter retained can be a promoter
recognized by RNA polymerase II. Such promoters are well known to a person
skilled in the art. The promoter can be isolated from a cellular gene or
from a virus. It can be ubiquitous, allowing a permanent expression of the
DNA fragment of interest in all the types of host cells. The term promoter
equally includes a regulatable promoter, for example a tissue-specific
promoter. It is possible especially to mention the promoter of the HMG
gene (hydroxymethylglutaryl coenzyme A reductase), of the TK gene of the
HSV-1 virus, of the SV40 virus (Simian virus 40), the promoters EIII and
MLP (Major Late Promoter) of the adenovirus, the LTR of the MoMuLV virus (Moloney
Murine Leukemia Virus), the promoter of the FIX gene which confers a
liver-specific expression or the promoter of specific immunoglobulin genes
of lymphocyte cells.
In an advantageous manner, the transposition assembly moreover comprises
an integration cassette of elements allowing or favoring the site-specific
integration of this cassette. According to a particular mode of the
invention, especially when the mobile genetic element employed is a mobile
intron of class I or II, the transposition assembly according to the
invention moreover comprises:
at the 5' end of the integration cassette a region of at most 10 kb,
having at least 80% homology with the sequences of the rRNA gene of the
host cell immediately adjacent at the 5' end at the said insertion site;
and
at the 3' end of the integration cassette a region of at most 10 kb having
at least 80% homology with the sequences of the rRNA gene of the host cell
immediately adjacent at the 3' end at the said insertion site. In fact, it
can be advantageous to place the said integration cassette in an rDNA
environment, particularly when the transposition involves a phenomenon of
exchange of strands as has been shown especially for the intron 3. The
exchange of strands involves the intron+donor sequences (of the
transposition assembly) and the intron-recipient sequences (of the host
cell). Only the integration cassette will be transposed into the genome of
the host cell. The sequences of the rRNA gene immediately adjacent at the
5' and 3' ends of the insertion site intervene uniquely in the
transposition process.
In order to favor the transposition of the integration cassette, it will
be preferred to have perfect homology between the donor and recipient
sequences involved in the strand exchange. Thus, a preferred transposition
assembly will moreover comprise:
at the 5' end of the integration cassette a region of at most 10 kb,
having 100% homology with the sequences of the rRNA gene of the host cell
immediately adjacent at the 5' end at the said insertion site; and
at the 3' end of the integration cassette a region of at most 10 kb,
having at least 100% homology with the sequences of the rRNA gene of the
host cell immediately adjacent at the 3' end at the said insertion site.
The sequences of the rRNA gene immediately adjacent at the 5' and 3' ends
at the insertion site can be isolated according to the classical
techniques of genetic engineering, for example by cloning or PCR (Polymerase
Chain Reaction) or chemical synthesis. More particularly, these sequences
will have a length of at most 10 kb, advantageously at most 3 kb and
preferably at most 0.4 kb.
The present invention equally relates to a means of introduction of a
transposition assembly according to the invention into a eukaryotic cell.
Such means consisting in introducing a nucleic acid into a eukaryotic cell
are generally known to a person skilled in the are.
For the purposes of the present invention, the transposition assembly
according to the invention can be introduced in a means of introduction
selected from amongst the delivery vehicles of the liposome and synthetic
cationic lipid type and the cloning and expression vectors classically
utilized in the eukaryotic cells. Encapsulation in a delivery vehicle and
the techniques of cloning in vectors are classical techniques known to the
person skilled in the art. However, other protocols allowing a nucleic
acid to be introduced into a cell can equally be employed, such as, for
example, calcium phosphate precipitation, the DEAE-dextran technique,
direct injection of the nucleic acid into a cell or the bombardment of
gold microparticles covered with nucleic acid in the cells of an animal.
The nucleic acid can be introduced in supercoiled, circular or linear
form.
Advantageously, the means of introduction according to the invention is a
vector comprising the elements appropriate for its maintenance in the host
cell for a time which is sufficiently long to allow the transfer of the
integration cassette into the insertion region. Such a vector has to be
capable of entering a higher eukaryotic cell, of remaining, preferably, in
extra-chromosomal form and of being maintained in the cell for a time
which is sufficiently long to allow the transposition of the integration
cassette into the genome of the host cell. Such a vector can be in the
form of a plasmid or of a viral vector.
Preferably, the means of introduction according to the invention is a
vector of the nonintegrative type. It is possible to mention a vector
derived from the herpes simplex virus or from an adenovirus. Particularly
preferably, the means of introduction according to the invention is a
vector derived from an adenovirus, such as, for example, type 5
adenovirus.
According to an advantageous mode and as recalled above, the means of
introduction according to the invention can moreover contain an expression
cassette allowing the production of the specific integrase of the
transposition assembly.
Such an expression cassette comprises the DNA fragment coding for the said
integrase, placed under the control of appropriate elements allowing its
expression. Appropriate elements allowing its expression is understood as
meaning the whole of the elements allowing the transcription of the said
fragment of DNA to mRNA and the translation of the mRNA to protein. These
elements especially comprise an appropriate promoter, preferably a
promoter recognized by the RNA polymerase II and allowing a strong and
ubiquitous expression, for example the promoter SV40.
The means of introduction according to the invention can moreover comprise
an expression cassette allowing the expression of a selection gene
allowing the detection and isolation of the host cells comprising the said
means of introduction. In the context of the invention, the gene coding
for the selection marker can be under the control of appropriate elements
allowing its expression in the host cell, such as defined above.
The invention is equally related to an in vitro transfer process of a DNA
fragment of interest into the genome of a eukaryotic host cell at the
level of the ribosomal nuclear DNA, according to which a transposition
assembly according to the invention or a means of introduction according
to the invention is introduced into the said host cell.
Advantageously, it is moreover possible to supply the specific integrase
of the transposition assembly according to the invention to the host cell
in the in vitro process according to the invention.
The invention equally relates to a eukaryotic cell comprising a
transposition assembly according to the invention or a means of
introduction according to the invention. The said cell will advantageously
be a mammalian cell, and preferably a human cell.
The present invention equally relates to a pharmaceutical composition
comprising by way of therapeutic agent, a transposition assembly according
to the invention, a means of introduction according to the invention or a
cell according to the invention, in association with a carrier which is
acceptable from a pharmaceutical point of view.
The pharmaceutical composition according to the invention is particularly
intended for the preventive or curative treatment of disorders such as:
genetic disorders, such as, for example, hemophilia or mucoviscidosis,
cancers, such as, for example, those induced by oncogenes or viruses,
retroviral disorders, such as, for example, AIDS (Acquired
Immunodeficiency Syndrome), and
recurrent viral disorders, such as, for example, viral infections caused
by the herpes virus.
A pharmaceutical composition according to the invention can be
manufactured in a conventional manner. In particular, a therapeutically
efficacious quantity of a therapeutic agent is united with a support such
as a diluent. A composition according to the invention can be administered
by any conventional route in use in the field of the art, in particular by
the subcutaneous route, by the intramuscular route, by the intravenous
route or by the intratracheal route. Administration can take place in a
single dose or repeated one or more times after a certain time interval.
The route of administration and the appropriate dose vary as a function of
various parameters, for example of the individual treated or of the DNA
fragment of interest. A pharmaceutical composition can moreover comprise
an adjuvant acceptable from a pharmaceutical point of view.
Advantageously, the pharmaceutical composition according to the invention
moreover comprises an integrase or an integrase expression cassette.
The invention equally extends to a method of treatment according to which
a therapeutically efficacious quantity of a transposition assembly
according to the invention, a means of introduction according to the
invention or a cell according to the invention is administered to a
patient having need of such a treatment.
Claim 1 of 12 Claims
What is claimed is:
1. A delivery vehicle including a transposition assembly for the
site-specific transfer of a DNA fragment of interest into the genome of a
mammalian host cell, said transposition assembly comprising an integration
cassette which is essentially formed by a mobile genetic element in the
midst of which is inserted said DNA fragment of interest; wherein (i) said
mobile genetic element is devoid of a long terminal repeat and comprises
an open reading frame coding for an integrase and (ii) said integration
cassette is capable of being integrated to an insertion site specific to
said genetic mobile element, said insertion site being a target sequence
situated in the ribosomal nuclear DNA of said host cell, and wherein said
transposition assembly is:
a) encapsulated into a liposome or synthetic lipid type vector, or
b) cloned into an expression vector.
____________________________________________
If you want to learn more
about this patent, please go directly to the U.S.
Patent and Trademark Office Web site to access the full
patent.
|