Title:  Process for expression and production of recombinant protein hybrid protein (p24/p17) derived from human immunodeficiency viruses (HIV-1)

United States Patent:  6,525,173

Issued:  February 25, 2003

Inventors:  Ferreira; Paulo Cesar Peregrino (Belo Horizonte, BR); Kroon; Erna Geessien (Belo Horizonte, BR)

Assignee:  Universidade Federal de Minas Gerais (Minas Gerais, BR)

Appl. No.:  142141

Filed:  May 12, 1999

PCT Filed:  December 30, 1997

PCT NO:  PCT/BR97/00085

PCT PUB.NO.:  WO98/29551

PCT PUB. Date: July 9, 1998

The present invention describes recombinant p24/p17 hybrid protein derived from the human immunodeficiency virus, their corresponding encoding recombinant DNA molecule and the process of production of the recombinant protein produced through genetic engineering techniques, to be used in diagnosis, vaccination or in research.

DETAILED DESCRIPTION OF THE INVENTION

The methodology used for the production of the recombinant hybrid p24/p17 protein of HIV-1consists of the cloning and expression, in microorganisms, of the DNA corresponding to the gene that codes recombinant hybrid p24/p17 protein of HIV-1 using the methodology of the genetic engineering.

In order to better understand this invention the following examples, for illustrative purposes only, are described. The examples illustrate the present invention and are not intended to limit it in spirit or scope. The process can be understood better through the following description in consonance with the examples.

EXAMPLE 1

Amplification of the DNA (1)

The amplification of the DNA (1) derived from the proviral DNA, or starting from the vector that contains the cloned DNA of the gene for P-24/p17 hybrid protein was developed using specific oligonucleotides 5' GGATCCCCGCTGACATGGAGCAAGGCG3 (SEQ ID NO. 1) and 5' CGCGAAGCTTCAGGCTCCATCTGTC3' (SEQ ID NO. 2). Those oligonucleotides were drawn to amplify, through polymerase chain reaction (PCR), the DNA region that encodes the corresponding fragment of the P-24/p17 hybrid protein. The primers also contains the sites for the restriction enzymes BamH-1 and Hind III.

The PCR reaction was performed by using Taq polymerase buffer (50 mM KCI, 100 mM Tris-HCI pH 9.0-9.5, 1.5-2.5 mM MgCI₂ and 1-2% triton X-100), 0.1-1 U of Taq polymerase (Promega ,E.U.A., Cat. no. M186A), 0.5-1.5 mM MgCI₂, 20-50 mM of each nucleotide (dATP,dCTP,dGTP,dTTP) 10-30 umoles of each primer, and 0.01a 0.1 .mu.g cDNA and H₂ O q.s.p. 50-100 .mu.I. The reaction was performed in 1-2 cycles at 94-96^oC./1-2 min; 53 to 55^oC. 1-2 min.; 70-72^oC./1-2 min; 30 cycles at 94-96^o C./1 to 2min; 36-38^oC./1-2min; 70-72^oC./1-2 min and more 1 cycle to 94-96^oC./1-2 min; 36-38^oC./1 to 2 min; 70-72^oC./10-15 min.

The PCR product was fractionated by electrophoresis in 1.5-2.0% agarose gel before purification of amplified fragment band was cutted out the gel. The fragment was purified by adding 2-3 times v/v of Nal solution (Nal 8M+0.022 M DTT) and sodium phosphate buffer (1M pH 6.0-6.5) and incubated for 5-10 min. at 50-56^oC. Glass beads were added to the suspension, mixed , incubated 1-5 min at room temperature and centrifuged 10-30 seconds . The pellet were washed with ethanol buffer(75% of ethanol, 0.01 M Tris-HCI, pH 7.0-7.6, 0.01 M EDTA, pH 8.0-8.5). The DNA was eluted from the glass spheres with buffer (Tris pH 7.0-7.4 10 mM, 1-3 mM EDTA) at 50-56^oC. for 1-5 min.

EXAMPLE 2

Cloning (2)

The PCR product was digested with enzyme Hind III with 10-20 U of Hind III (Biolabs, England) plus 3-5 I buffer (Promega, EUA) in 30-50 .mu.l volume of H₂ O. The reactions were incubated at 37^oC. for 2-4 h. After this time 10-20 U of Bam HI (Biolabs, England) plus 5-10 .mu.I of react III buffer (BRL, USA) were added to a final 50-100 .mu.I volume of H₂ O dd and it was incubated at 37^oC. for 2-4 h. For cloning of the PCR product into plasmid PDS-56 (FIG. 1), the vector was digested with 10-20 U of enzyme Hind III(Promega, USA), 2-5 .mu.I buffer I B (Promega,E.U.A.) in 20-50 .mu.I final volume of H₂ O , and incubation at 37^oC. for 2-4 h. To the reaction was added 10-20 U of the enzyme Bam Hi (Promega, USA), 5-10 .mu.I of react III (BRL, E.U.A), in 50-100 .mu.final volume of H₂ O , and incubation at 37^oC. for 2-4 h. After digestion the DNA was fractionated by electrophoresis in a 1-2% TAE-agarose gel and bands purified as already described.

The ligation reaction was performed by adding 20-50 ng of the DNA fragment insert, 5-15 ng of the vector DNA, plus 0.5-2.0 U of T4 ligase (Promega, USA), 5mM ATP (Promega,E.U.A.), ligation buffer(Promega,E.U.A.), H₂ O dd qsp 15 .mu.I, with incubation at 14-16^oC. (BOD, FANEN, Brazil) for 12-18 h.

EXAMPLE 3

Transformation (3)

The bacterial transformation was done with Escherichia coli by adding the ligation reaction completed to 40-60 .mu.l volume buffer (Tris 10 mM pH 7.2-7.4, EDTA 1 mM) to 100 .mu.l of competent bacteria suspension. The tubes were slightly rotated and immediately incubated on ice bath for 20-40 min. After that, they were submitted to a thermal shock at 40-42^oC. for 1-3 min. and kept on ice bath for further 20-40 seconds. LB medium (Bacto triptona 1% p/v, extract of yeast 0.5% p/v, NaCl 171 mM) without antibiotic was added at double volume and incubated at 37^oC. for 1-2h. The bacteria were pelleted, homogenized in LB and inoculated in Petri dish plates with LB agar (agar 1.5% p/v, yeast extract 0.5% p/v, triptone 0.1% p/v, NaCl 0.5% p/v pH 7.2-7.5) with 50-200 pg/ml ampicillin and 20-100 pg/ml kanamycin. The plates were incubated at 37^oC. for 15-24 h. For the selection of the positive clones they were grown in LB with 50-200 pg/ml ampicillin and 20-100 pg/ml kanamycin at 37^oC. under agitation for 15-20 h. After incubation a PCR using specific primers of the vector (for amplification of the area corresponding to insert) being the primer (sense) 5'-TTCATTAAAGAGGAGAAATT-3'(SEQ ID NO. 3) and primer (anti-sense) 5'-CTATCAACAGGAGTCCAAGC-3'(SEQ ID NO. 4). The reaction was made with Taq. polymerase buffer10X (KCl 500 mM, Tris-HCl 100 mM pH 9.0-9.5, MgCl₂ 15-25 mM and triton X-100 1-2%), 0.5-1.0 U of Taq polymerase (Promega, USA), 0.5-1.5 mM MgCl₂, 20-50 mM of each nucleotide (dATP, dCTP, dGTP, dTTP), 10-30 pmoles of each primer, 0.5-1 .mu.l of bacterial suspension and H₂ Odd sterile qsp 20-40 .mu.l.

The reaction was processed with 1-3 cycles of 94-96^oC./5 min., 50-55^oC./1-2 min., 70-72^oC./1-2 min., 30 cycles of 94-96^oC./30-45 seg., 45-50^oC./30-45 seg., 70-72^o C./30-45 seg. and 1 cycle of 94-96^oC./1-2 min., 45-50^oC./1-2 min., 70-72^oC./10-15 min. The of this reaction was fractionated through 1-2%. agarose gel electrophoresis.

EXAMPLE 4

Sequencing (4)

The positive clones were sequenced to confirm the sequence of FIG. 2 and presents the hydrofilicity profile as showed in FIG. 3.

EXAMPLE 5

Protein production (5)

The positive clones were used for production of protein and they were grown in LB medium with 50-200 .mu.g/ml ampicillin, 50-200 of Kanamycin .mu.g/ml and incubated at 37^oC. under agitation until the optical density (OD 600 nm) of 0.5-0.7. Then, for the induction of the protein, IPTG(Isopropyl-.quadrature.-D-thiogalactpyranoside) to 0.2-0.4 M was added and incubated for 3-5 h. The bacteria were centrifuged, the supernatant was discarded and the pellet homogenized in buffer A (guanidine-HCI 5-6 M, sodium phosphate 0.1-0.2 M, Tris 0.01-0.02 M pH 7.8-8.0) with agitation for 1-2 h. A polyacrylamide gel shows the expression in the bacteria. (FIG. 4)

EXAMPLE 6

Protein purification (6)

After the centrifugation the supernatant was applied to a column with Ni-NTA (nickel chelate) resin. For purification of the protein the column was washed sequentially with buffer A, buffer B (Urea 7-8 M, phosphate of sodium 0,1-0,2 M, Tris 0.01-0.02 M pH 7.8-8.0) and with buffer C (Urea 7-8 M, phosphate of sodium 0.1-0.2 M, Tris 0.01-0.02 M pH 7.0-7.2). The protein was eluted with buffer D (Urea 7-8 M, sodium phosphate 0.1-0.2 M, Tris 0.01-0.02 M pH 5.0-5.2) and sequentially with urea 7-8 M, phosphate of sodium 0.1-0.2 M, Tris 0.01-0.02 M pH 40-4.2. Fractions were collected and 50 .mu.I of each fraction was diluted v/v in sample buffer, heated for 10 min. and submitted to electrophoresis in polyacrylamide gel (SDS-PAGE).

While the present invention has been described in connection with examples, it will be understood that modifications and variations apparent to those ordinary skill in the art are within the scope of the present invention.
 

What is claimed is:

1. A recombinant hybrid p24/p17 protein of HIV-1 consisting of SEQ ID NO. 5.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.