|
|

Title: Diagnosis and management of infection caused by
chlamydia
United States Patent: 6,579,854
Issued: June 17, 2003
Inventors: Mitchell; William M. (Nashville, TN); Stratton;
Charles W. (Nashville, TN)
Assignee: Vanderbilt University (Nashville, TN)
Appl. No.: 073661
Filed: May 6, 1998
Abstract
The present invention provides a unique approach for the diagnosis and
management of infections by Chlamydia species, particularly C. pneumoniae.
The invention is based, in part, upon the discovery that a combination of
agents directed toward the various stages of the chlamydial life cycle is
effective in substantially reducing infection. Products comprising
combination of antichlamydial agents, novel compositions and pharmaceutical
packs are also described.
DETAILED DESCRIPTION OF THE INVENTION
This invention describes specific antichlamydial agents that are used
singly or in combination to eliminate or interfere with more than one of the
distinct phases of the life cycle of Chlamydia species. These chlamydial
phases include the intracellular metabolizing/replicating phase; the
intracellular "cryptic" phases; and the extracellular EB phase. Current
concepts of susceptibility testing for chlamydiae and antimicrobial therapy
for their associated infections address only one phase, the replicating
phase. Unless multiple phases of the life cycle are addressed by
antichlamydial therapy, the pathogen is likely to escape the desired effects
of the antimicrobial agent(s) used and cause recurrent infection after
reactivation from latency. For the purposes of this invention, "cryptic
phase" embraces any non-replicating, intracellular form, of which there are
a number of distinct stages, including but not limited to intracellular EBs,
EBs transforming into RBs and vice versa, miniature RBs, non-replicating RBs
and the like.
Diagnostic and therapeutic methods for the management of Chiamydia
infections are described in detail below. For the purposes of this
invention, "management of Chlamydia infection" is defined as a substantial
reduction in the presence of all phases/forms of Chlamydia in the infected
host by treating the host in such a way as to minimize the sequellae of the
infection. Chlamydia infections can thus be managed by a unique approach
referred to herein as "combination therapy" which is defined for the purpose
of this application as the administration of multiple agents which together
are targeted at least two but preferably many of the multiple phases of the
chlamydial life cycle, each agent taken separately, simultaneously or
sequentially over the course of therapy. When used alone, these agents are
unable to eliminate or manage chlamydial infection. The diagnostic methods
and combination therapies described below are generally applicable for
infection caused by any Chlamydia species, including but not limited to C.
pneumoniae, C. trachomatis, C. psittaci and C. pecorum. Infections in which
the causative agent is C. pneumoniae are emphasized.
Antichlamydial agents, which have been identified as effective against
Chlamydia by the susceptibility testing methods described herein, can be
used singly to affect Chlamydia in a single stage of its life cycle or as
part of a combination therapy to manage Chlamydia infection. For example,
compounds identified as anti-cryptic phase drugs, anti-EB phase drugs,
anti-DNA-dependent RNA polymerase drugs and nicotinic acid cogener drugs can
be used alone or in combination to eliminate, reduce or prevent one or more
of the distinct phases of the chlamydial life cycle. Certain of these
compounds have not heretofore been shown to have antichlamydial activity.
Diagnosis of Chlamydia Infection
The invention pertains to methods for diagnosing the presence of Chlamydia
in a biological material, as well as to the use of these methods to evaluate
the serological status of an individual undergoing antichlamydial
combination therapy. For purposes of this application, "biological material"
includes, but is not limited to, bodily secretions, bodily fluids and tissue
specimens. Examples of bodily secretions include cervical secretions,
trachial-bronchial secretions and pharyngeal secretions. Suitable bodily
fluids include blood, sweat, tears, cerebral spinal system fluid, serum,
sputum, ear wax, urine, snyovial fluid and saliva. Animals, cells and tissue
specimens such as from a variety of biopsies are embraced by this term.
In one embodiment, peptide-based assays are disclosed for the detection of
one or more immunoglobulins, such as IgG, IgM, IgA and IgE, against
antigenic determinants within the full length recombinant MOMPs of various
Chlamydia species. Detection of IgG and/or IgM against antigenic
determinants within the full length recombinant MOMP of C. pneumoniae is
preferred. IgA determinations are useful in the analysis of humoral
responses to Chlamydia in secretions from mucosal surfaces (e.g., lung, GI
tract, gerontourinary tract. etc.). Similarly, IgE determinations are useful
in the analysis of allergic manifestatins of disease. Table 1 below provides
the GenBank Accession numbers of various MOMPs for Chlamydia species.
TABLE 1
GenBank
Species Strain ID Accession No.
C. trachomatis A CTL/A M33636
C. trachomatis A CTL/A M58938
M33535
C. trachomatis A CTL/A J03813
C. trachomatis B CTL/B M33636
C. trachomatis C CTL/L M17343
M19128
C. trachomatis D CTL/D A27838
C. trachomatis E CTL/E X52557
C. trachomatis F CTL/F X52080
M30501
C. trachomatis H CTL/H X16007
C. trachomatis L1 CTL/L1 M36533
C. trachomatis L2 CTL/L2 M14738
M19126
C. trachomatis L3 CTL/L3 X55700
C. trachomatis Mouse Pneumo CTL/MP X60678
C. pecorum Ovine CPC/OP Z18756
Polyarthritis
C. psittaci Strain 6BC CPS/6B X56980
C. psittaci Feline CPS/F X61096
C. trachomatis Da CTL/DA X62921
S45921
C. pneumoniae TWAR CPN/HU1 M64064
M34922
M64063
C. pneumoniae Horse CPN/EQ2 L04982
(? C. pecorum)
C. pneumoniae TWAR CPN/MS not assigned
C. psittaci Horse CPS/EQ1 L04982
For example, a biological material, such as a sample of tissue and/or
fluid, can be obtained from an individual and a suitable assay can be used
to assess the presence or amount of chlamydial nucleic acids or proteins
encoded thereby. Suitable assays include immunological methods such as
enzyme-linked immunosorbent assays (ELISA), including luminescence assays
(e.g., fluorescence and chemiluminescence), radioimmunoassay, and
immunohistology. Generally, a sample and antibody are combined under
conditions suitable for the formation of an antibody-protein complex and the
formation of antibody-protein complex is assessed (directly or indirectly).
In all of the diagnostic methods described herein, the antibodies can be
directly labeled with an enzyme, fluorophore, radioisotope or luminescer.
Alternatively, antibodies can be covalently linked with a specific scavenger
such as biotin. Subsequent detection is by binding avidin or strepavidin
labeled with an indicator enzyme, flurophore, radioisotope, or luminescer.
In this regard, the step of detection would be by enzyme reaction,
fluorescence, radioactivity or luminescence emission, respectively.
The antibody can be a polyclonal or monoclonal antibody, such as anti-human
monoclonal IgG or anti-human monoclonal IgM. Examples of useful antibodies
include mouse anti-human monoclonal IgG that is not cross reactive to other
immunoglobulins (Pharmagen; Clone G18-145, Catalog No. 34162D); mouse
anti-human monoclonal IgM with no cross reactivity to other immunoglobulins
(Pharmagen; Clone G20-127, Catalog No. 34152D). Peptide-based immunoassays
can be developed which are Chlamydia specific or provide species
specificity, but not necessarily strain specificity within a species, using
monoclonal or polyclonal antibodies that are not cross-reactive to antigenic
determinants on MOMP of a chlamydial species not of interest.
Recombinant-based immunological assays have been developed to quantitate the
presence of immunoglobulins against the Chlamydia species. Full length
recombinant Chlamydia MOMP can be synthesized using an appropriate
expression system, such as in E. coli or Baculovirus. The expressed protein
thus serves as the antigen for suitable immunological methods, as discussed
above. Protein-based immunological techniques can be designed that are
species- and strain-specific for various Chlamydia.
Diagnosis of chlamydial infection can now be made with an improved IgM/IgG
C. pneumoniae method of quantitation using ELISA techniques, Western blot
confirmation of ELISA specificity and the detection of the MOMP gene of C.
pneumoniae in serum using specific amplification primers that allow
isolation of the entire gene for analysis of expected strain-specific
differences.
Any known techniques for nucleic acid (e.g., DNA and RNA) amplification can
be used with the assays described herein. Preferred amplification techniques
are the polymerase chain reaction (PCR) methodologies which comprise
solution PCR and in situ PCR, to detect the presence or absence of unique
genes of Chlamydia. Species-specific assays for detecting Chlarnydia can be
designed based upon the primers selected. Examples of suitable PCR
amplification primers are illustrated below in Table 2. Examples of
preferred primers are illustrated in Table 3.
TABLE 2
Initial and Terminal Nucleotide Sequences of Chlamydial
MOMP Genes
in which entire sequence is known
SEQ ID
GenBank Accession No. ID Initial Fifty Nucleotides
NO.
M64064/M34922/M64063 CPNHU1
ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC 1
None CPNHU2a
ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC 2
L04982 CPNEQ1
ATGAAAAAACTCTTGAAGTCGGCATTATTGTTTGCCGCTACGGGTTCCGC 3
L04982 CPNEQ2
ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC 4
X56980 CPS/6B
ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC 5
M36703 CPS/AB1
ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC 6
L39020 CPS/AB2
ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC 7
L25436 CPS/AV/C
ATGAAAAAACTCTTGAAATCGGCATTATTATTTGCCGCTACGGGTTCCGC 8
X61096 CPS/F
ATGAAAAAACTCTTAAAATCGGCATTATTATTTGCCGCTGCGGGTTCCGC 9
M33636/N58938/J03813 CTL/A
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 10
M17343/M19128 CTL/C
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 11
X62921/S45921 CTL/DA
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 12
X52557 CTL/E
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 13
X52080/M30501 CTL/F
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 14
X16007 CTL/H
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 15
M36533 CTL/L1
ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC 16
M14738/M19126 CTL/L2
ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC 17
X55700 CTL/L3
ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC 18
X60678 CTL/MP
ATGAAAAAACTCTTGAAATCGGTATTAGCATTTGCCGTTTTGGGTTCTGC 19
Chlamydial
SEQ ID
Species Strain ID Terminal Fifty Nucleotides
NO.
C. pneumoniae TWAR CPNHU1
GTTTAATTAACGAGAGAGCTGCTCACGTATCTGGTCAGTTCAGATTCTAA 20
C. pneumoniae MS CPNHU2
GTTTAATTAACGAGAGAGCTGCTCACGTATCTGGTCAGTTCAGATTCTAA 21
C. psittaci Horse CPNEQ1
CAACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTA 22
C. pneumoniae Horse CPNEQ2
GTTTAATTAACGAGAGAGCTGCTCACATATCTGGTCAGTTCAGATTCTAA 23
C. psittaci SBE CPS/6B
AACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTAA 24
C. psittaci Ewe CPS/AB1
AACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTAA 25
abortion
C. psittaci Bovine CPS/AB2
GCTTAATCAATGAAAGAGCCGCTCACATGAATGCTCAATTCAGATTCTAA 26
abortion
C. psittaci Avian CPS/AV/C
GCTTAATCAATGAAAGAGCTGCTCACATGAATGCTCAATTCAGATTCTAA 27
C. psittaci Feline CPS/F
GCTTAATCGACGAAAGAGCTGCTCACATTAATGCTCAATTCAGATTCTAA 28
C. trachomatis Hu/A CTL/A
CGCAGTTACAGTTGAGACTCGCTTGATCGATGAGAGAGCAGCTCACGTAA 29
C. trachomatis Hu/C CTL/C
GCTTGATCGATGAGAGAGCAGGTCACGTAAATGCACAATTCCGGTTCTAA 30
C. trachomatis Hu/Da CTL/DA
GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA 31
C. trachomatis HU/E CTL/E
CGCTTGATCGATGAGAGACTGCTCACGTAAATGCACAATTCCGCTTCTAA 32
C. trachomatis Hu/F CTL/F
GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA 33
C. trachomatis Hu/H CTL/H
GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA 34
C. trachomatis Hu/L1 CTL/Li
GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA 35
C. trachomatis Hu/L2 CTL/L2
GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA 36
C. trachomatis Hu/L3 CTL/L3
GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA 37
C. trachomatis Mouse CTL/MP
GCTTGATCGATGAAAGAGCAGCTCACGTAAATGCTCAGTTCCGTTTCTAA 38
a Sequence from a cerebral spinal fluid of a patient with multiple
sclerosis isolated by the inventors. Sequence is identical to TWAR C.
pneumoniae with exception of a C/T mutation at NT 54 and a G/A mutation at
NT 126.
b Terminator condon underlined
TABLE 3
Primers for PCR Amplification of Entire MOMP Genea
Chlamydia
SEQ ID
Species Strain ID Sequence
Tmb NO.
Plus Strand Primer
C. pneumoniae TWAR CHLMOMP ATGAAAAAAC TCTTAAAGTC GGCGTTATTA
61.4o 105
DB2 TCCGCCGC
C. trachomatis L2 CTMOMP ATGAAAAAAC TCTTGAAATC GGTATTAGTG
61.2o 106
L2DB TTTGCCGCTT TGAG
C. psittaci Feline PSOMP ATGAAAAAAC TCTTAAAATC GGCATTATTA
62.1o 107
FPN-D TTTGCCGCTG CGGG
C. psittaci 6BC PSOMP ATGAAAAAAC TCTTGAAATC GGCATTATTG
63.0o 108
6BC-b TTTGCCGCTA CGGG
C. trachomatis Mouse CTMU ATGAAAAAAC TCTTGAAATC GGTATTAGCA
63.5o 109
MOMP-D TTTGCCGTTT TGGGTTCTGC
Minus Strand Primer
C. pneumoniae TWAR CHLMOMP TTAGAATCTG AACTGACCAG ATACGTGAGC
64.4o 110
CB2 AGCTCTCTCG
C. trachomatis L2 CTMOMP TTAGAAGCGG AATTGTGCAT TTACGTGAGC
61.5o 111
L2CB AGCTC
C. psittaci Feline PSOMP TTAGAATCTG AATTGAGCAT TAATGTGAGC
62.2o 112
FPN_C AGCTCTTTCG TCG
C. psittaci 6BC PSOMP TTAGAATCTG AATTGACCAT TCATGTGAGC
63.4o 113
GBC_C AGCTCTTTCA TTGATTAAGC G
C. trachomatis Mouse CTMU TTAGAAACGG AACTGAGCAT TTACGTGAGC
63.2o 114
MOMP_C TGCTCTTTCA TC
a All primers amplify under identical amplification conditions:
94o C. for 1 min., 58o C. for 2 min., 74o C. for 3
min., for 35 cycles with 72o C. for 10 min. extension of last
cycle.
b Melting temperature in degrees Celsius of a nucleic acid isomer
based on the equation of Mermur and Doty (J. Mol. Biol. 5: 109-118, 1962)
where Tm = 81.5 + 16.6 log10 (Na+ /K+) + 41 (GC) -
600/L where (Na+ /K+) in the molar cation concentration, GC in
the mole fraction of GC and L is the sequence fragment length. (Na+
/K+) used for computation was 0.05M.
Ligase chain reaction can also be carried out by the methods of this
invention; primers/probes therefor can be constructed using ordinary skill.
Amplification of the entire MOMP gene is useful for mutational analysis and
the production of recombinant MOMP. Shorter primers can be used for specific
amplification of most of the MOMP genome with a modification of
amplification protocol. For example, a 22 bp negative strand primer of the
sequence 5'-CAGATACGTG AGCAGCTCTC TC-3'(CPNMOMPC; SEQ ID NO. 39) with a
computed Tm =55o plus a 25 bp positive strand primer of the
sequence 5'-CTCTTAAAGT CGGCGTTATT ATCCG-3'(CPNMOMPD; SEQ ID NO. 40) with a
computed Tm =53.9o can be used as a primer pair by adjusting the
hybridization step in the amplification protocol (Table 2) from 58o
C. to 50o C. Similarly, smaller regions of MOMP can be amplified by a
large variety of primer pairs for diagnostic purposes although the utility
of strain identification is reduced and amplification may be blocked if one
or both primer pairs hybridize to a region that has been mutated. Extensive
experience with the full length MOMP PCR amplification indicates that
mutational events within the CHLMOMPDB2 and CHLMOMPCB2 hybridization sites
are rare or non-existent.
The nucleic acid amplification techniques described above can be used to
evaluate the course of antichlamydial therapy. The continued absence of
detectable chlamydial DNA encoding MOMP as a function of antichlamydial
therapy is indicative of clinical management of the chlamydial infection.
Serological improvement can be based upon the current serological criteria
for eradication of chronic Chlamydia reported below in Table 4.
TABLE 4
Serological Criteria for Eradication
of Chronic Chlamydia pneumoniae Infection
IgM .ltoreq.1:25
IgG Stable titer 1:100
PCR Negative
Preferred PCR techniques are discussed in detail below in the Example
Section. In general, solution PCR is carried out on a biological material by
first pre-incubating the material in an appropriate reducing agent that is
capable of reducing the disulfide bonds which maintain the integrity of the
MOMP and other surface proteins of the chlamydial elementary bodies, thereby
compromising the outer protective shell of the EBs and allowing protease
penetration. Suitable disulfide reducing agents include, but are not limited
to, dithiothreitol, succimer, glutathione, DL-penicillamine, D-penicillamine
disulfide, 2,2'-dimercaptoadipic acid, 2,3-dimercapto-1-propone-sulfide
acid. Appropriate concentrations ofthese reducing agents can be readily
determined by the skilled artisan without undue experimentation using a 10 .mu.M
concentration of dithiothreitol (the preferred reducing agent) as a
guideline. Failure to include a reducing agent in the initial step may
prevent DNA of EBs from being isolated in the subsequent step. Data
presented in Example 1 shows the effects of various reducing agents on the
susceptibility of EBs to proteinase K digestion. The in vitro data shows
that dithiothreitol is most effective at opening EBs for protease digestion.
Once the outer shell of the EBs has been released, the pre-incubated
material is subjected to protein digestion using a protease (e.g.,
proteinase K), or functionally equivalent enzyme. The DNA is extracted and
subjected to a nucleic acid amplification technique, e.g., PCR. The entire
gene or portion thereof containing unique antigenic determinant(s) encoding
MOMP or other suitable gene can then be amplified using appropriate primers
flanking the gene to be amplified. For example, the gene or portion thereof
can be the gene encoding MOMP, OMP-B, GRO-ES, GRO-EL, DNAK, 16S RNA, 23S
RNA, the gene encoding ribonuclease-P, a 76 kd attachment protein or a
KDO-transferasc gene. In an alternative method, guanidine thiocyanate, at
preferably a concentration of 4M, or functionally equivalent reducing
denaturant may be substituted for the disulfide reduction/protease steps.
The amplified DNA is then separated and identified by standard
electrophoretic techniques. DNA bands are identified using ethidium bromide
staining and UV light detection. PCR primers can be designed to selectively
amplify DNA encoding MOMP of a particular Chlamydia species, such as the
MOMP of C. pneumoniae, C. pecorum, C. trachomatis, C. psittaci (See FIG. 1).
Primers that are from about 15-mer to about 40-mer can be designed for this
purpose.
For in situ PCR, the amplification primers are designed with a reporter
molecule conjugated to the 5'-terminus. Suitable reporter molecules are well
known and can be used herein. However, biotin-labeled primers are preferred.
For the MOMP gene, the primers CHLMOMPDB2 and CHLMOMPCB2 have been
engineered with a biotin at the 5'-terminus. For in situ PCR, using biotin
labels incorporated at the 5'-terminus of the amplification primers, each
DNA chain amplification results in each double strand DNA containing 2
molecules of biotin. Alternatively, other specific DNA sequences can be
used, although the above-described sequence is the preferred embodiment
since the large product produced (1.2 kb) prevents diffusion that may be
encountered with smaller DNA amplifications. Similarly, other detection
labels can be incorporated (i.e., fluorescein, for example) at the 5'-end or
digoxigenin-dUTP (replacement for dTPP) can be incorporated within the
amplified DNA. Alternatively to labeling the product, specific hybridization
probes to constant regions of the amplified DNA can be used to identify an
amplified product. This latter method has particular utility for the
construction of automated laboratory equipment for solution-based PCR. For
example, strepavidin-coated ELISA plates can be used to capture one or both
strands of a biotin 5'-labeled DNA with detection by fluorescence of a
fluorescein or other incorporated fluorophore detection probe.
Clearing and Maintaining Chlamydia-free Organisms
The present invention provides a unique approach for creating and
maintaining animals and cell lines which are free of Chlamydia infection.
Also described herein are methods for creating nutrients and culture media
that are suitable for use with animals and cell lines that have been cleared
of Chlamydia infection.
Attempts to culture isolates of C. pneumoniae from blood and cerebrospinal
fluid (CSF) have resulted in the discovery that the continuous cell lines
routinely used to cultivate C. pneumoniae are cryptically infected with C.
pneumoniae. These include not only in house stocks of HeLa, HL, H-292,
HuEVEC and McCoy cells, but also stocks obtained from the American Type
Culture Collection (ATCC), The University of Washington Research Foundation
for HL cells, as well as a commercial supplier (Bartells) of H-292 and McCoy
cells for the clinical culture of Chlamydia. The presence of a cryptic form
of C. pneumoniae in these cells has been repeatedly demonstrated by solution
PCR amplifying the MOMP. In situ PCR in HeLa cells against the MOMP
demonstrates the MOMP genes to be present in 100% of cells. Nevertheless,
fluoroscenated mAb to LPS in McCoy cells does not yield any indication of
Chlamydia (i.e., reactive against all Chiamydia) while fluoroscenated mAb to
C. pneumoniae MOMP yields a generalized fluorescence throughout the
cytoplasm that can be confused with non-specific autofluorescence. Infection
with Chlamydia trachomatis (Bartells supply) yields the typical inclusion
body staining with the LPS mab (i.e., cross reactive with all species of
Chlamydia) with no change in cytoplasmic signal with anti-MOMP mAb against
C. pneumoniae. These findings (solution PCR, in situ PCR, mAb reactivity)
were interpreted as consistent with a cryptic (non-replicating) infection by
C. pneumoniae of cells commonly used to culture the organism. Further,
virtually all untreated rabbits and mice tested to date have PCR signals for
the C. pneumoniae MOMP gene.
This creates a currently unrecognized problem of major significance for
those clinical labs providing C. pneumoniae culture services as well as
investigators who now do not know whether their results in animals or in
cell culture will be affected by cryptic chlamydial contamination. Clinical
and research laboratories currently have no way to determine whether an
organism is, in fact, Chlamydia-free.
This invention pertains to a method for clearing cells and animals of C.
pneumoniae and keeping them clear. Clearing them entails contacting the
infected organism with agents used singly or in combination to eliminate or
interfere with more than one of the distinct phases of the life cycle of
Chlamydia species. Keeping them clear entails either maintaining them on
antibiotics and/or treating their nutrients and environment to ensure they
are Chlamydia-free. In a preferred embodiment, maintenance conditions
comprise a combination of isoniazid (INH) (1 .mu.g/ml), metronidazole (1 .mu.g/ml),
and dithiothreitol (10 .mu.M) in the culture medium. Media changes are
accomplished every 3 days or twice per week. The cells can be removed from
the protective solution between 1 and 7 days before they are to be used for
culture or other purpose.
These techniques have now made it possible to create a variety of
Chlamydia-free (CF) organisms, including continuous cell lines called HeLa-CF,
HL-CF, H-292-CF, HuEVEC-CF, McCoy-CF, African green monkey and other cell
lines that are capable of supporting chlamydial growth. Various CF strains
of mice, rabbits and other animal models for research use can be produced.
Because Chlamydia is highly infectious, organisms which have been cleared of
extracellular, replicating and cryptic infections must be protected from
exposure to viable EBs if the organisms are to remain clear. The inventors
have discovered that many of the nutrients and other materials used to
maintain continuous cell lines are contaminated with viable Chlamydia EBs.
For example, every lot of fetal calf serum has tested positive for the
Chlamydia MOMP gene by PCR. Since extensive digestion is required for
isolation of the DNA, we have concluded it is bound in EBs. C. pneumoniae
can also be cultured directly from fetal calf serum. Thus, it is necessary
to inactivate EBs in these materials, such as culture media and nutrients,
used to maintain the Chlamydia-free status of the organism. Collectively
these materials are referred to herein as "maintenance materials"). In one
embodiment, nutrients and culture media are subjected to gamma irradiation
to inactivate Chlamydia therein. Preferably, the material should be
irradiated for a period of time sufficient to expose the material to at
least 10,000 rads of gamma radiation. It is important for the material to be
contained in vessels that do not absorb high energy radiation. The preferred
vessel is plastic. In another embodiment, the maintenance materials are
treated with a disulfide reducing agent (e.g.,dithiothreitol (10 .mu.M) for
about 30 minutes) and then the treated maintenance materials are passed
through a standard submicron (e.g., about 0.45 microns) filtration system.
The reducing agent causes any EBs to expand to the size where a 0.45 micron
filter will block their passage. Examples of suitable disulfide reducing
agents include, but are not limited to, dithiothreitol, succimer,
glutathione, DL-penicillamine, D-penicillamine disulfide,
2,2'-dimercaptoadipic acid, 2,3-dimercapto-1-propone-sulfide acid. In yet
another embodiment, maintenance materials are treated with a disulfide
reducing agent, preferably dithiothreitol (e.g., about 10 .mu.M
concentration), before the materials are passed through a filtration system
to remove Chlamydia therefrom.
In order to insure that research tools, such as cell lines and animals,
remain Chlamydia-free, an assay has been designed to evaluate whether an
organism is Chlamydia-free. The method comprises obtaining a sample of cells
or tissue culture; optionally culturing the cells in the presence or absence
of cycloheximide; and determining the presence or absence of Chlamydia
nucleic acid by a suitable amplification technique, such as PCR. The absence
of nucleic acid amplification signal is indicative that the status of the
organism is Chiamydia-free.
Susceptability Testing for Evaluating Active Agents Against Various Forms of
Chlamydia
This invention pertains to novel approaches for the susceptibility testing
of Chlamydia species that are necessitated by the complex life cycle of the
chlamydial pathogen as well as by its diverse, extensive, and heretofore
unappreciated ability to cause chronic, cryptic and persistent systemic
infections that are refractory to short duration therapy with conventional
single agents. The inventors have discovered that successful management or
eradication of chronic/systemic chlamydial infections can be predicted by
using the described unique methods for in vitro and in vivo susceptibility
testing.
The invention is based upon the discovery that current susceptibility
testing methods for Chlamydiae do not accurately predict the ability of
antimicrobial agents to successfully and totally eradicate chronic
chlamydial infections. This is because the current susceptibility testing
methods measure only replication of chlamydia and ignores the well-known
"cryptic phase" in which intracellular Chlamydiae are not actively
replicating. Moreover, it has also been discovered that the so-called
"cryptic phase" of Chlamydiae includes multiple and different sub-phases.
The following are some of the phases of the chlamydial life cycle in which
the intracellular Chlamydiae are not replicating: an initial intranuclear
phase in which elementary bodies (EBs) transition to reticulate bodies (RBs),
an intracytoplasmic phase in which there is a transition of the RB phenotype
to the EB phenotype, an intracytoplasmic phase with a nonreplicating, but
metabolizing RB, and intracellular/extracellular EB phases, including
endocytotic and exocytotic phases, in which there is neither replication nor
metabolism. In order to assess the cumulative and long term effect of
antimicrobial therapy on these multiple life phases, unique in vitro and in
vivo susceptibility test methods have been developed and are described
herein.
The term "susceptibility" as used herein is intended to mean a physiological
response of an organism to an environmental or chemical stimuli. The desired
physiological response to stimuli is one which adversely affects the
pathogen's viability to replicate or reside within the host cell and,
ideally, would result in the reduction or complete elimination (i.e., death)
of that pathogen.
A. In Vitro Methodology
One aspect of the invention pertains to methods for evaluating the
susceptibility of the distinct phases and stages of the life cycle of
Chlamydia, particularly the cryptic phase to a particular agent(s), since
prior techniques have failed, heretofore, to appreciate the need for drugs
that can clear infected cells of cryptic Chlamydia. A preferred drug
screening method which accomplished this objective utilizes tissue culture
cells which are maintained, in the absence of cycloheximide in order to
encourage cryptic infection. Cryptic infection is uncommon in cells used in
standard cell culture susceptibility techniques because Chlamydia in
cycloheximide-paralyzed cells need not compete with the host cell for
metabolites and hence are encouraged to replicate.
The in vitro method uses standard tissue culture cells, but without the
addition of cycloheximide. Moreover, the chlamydiae are allowed to replicate
for several days prior to the addition of one or more test agents. A "test
agent" can be any compound or combination of compounds to be evaluated as an
antichlamydial agent for its ability to significantly reduce the presence of
Chlamydia in living cells. For example, a test agent can include, but is not
limited to, antibiotics, antimicrobial agents, antiparasitic agents,
antimalarial agent, disulfide reducing agents and antimycobacterial agents.
Antimicrobial agent(s) (test agent) is then added to the replicating cells.
The antimicrobial agents/growth medium are periodically replaced for the
duration of the incubation time, which is preferably weeks rather than days.
The test agent(s) is/are replaced when needed for the duration of the
incubation time (days to weeks) to ensure that the test agent is present and
has not been otherwise degraded. Finally, the end point after the prolonged
incubation time is the complete absence of chlamydial DNA, as determined by
a nucleic acid amplification technique, such as the polymerase chain
reaction (PCR) methodology. Standard nucleic acid amplification techniques
(such as PCR) are used to ascertain the presence or absence of signal for
chlamydial DNA encoding MOMP or another unique Chlamydia gene to determine
whether the test agent or combination of agents is/are effective in reducing
Chlamydia infection. The loss of signal (i.e., below the detectable level of
the nucleic acid amplification technique) in cells with antibiotic(s) versus
its presence in controls is an indication of efficacy of the agent or
combination of agents against Chlamydia.
Accordingly, the susceptibility test of this invention can be used to
identify an agent or agents which are targeted against any particular
species of Chlamydia and can be used to identify agent(s) targeted against
the cryptic form of the pathogen, i.e., is capable of inhibiting or
eliminating the cryptic form of the pathogen. In one embodiment, this is
done by performing the susceptibility test while placing the cells under
stringent environmental conditions known to induce Chlamydia to enter a
cryptic phase. Agents that are effective against Chlamydia, as ascertained
by the susceptibility testing protocols described herein, can be used as
part of a therapy for the management of Chlamydia infections. Suitable
therapeutic protocols are described in detail below, with a particular focus
on targeting agents toward specific stages of the chlamydial life cycle.
The methods described herein are unique because they evaluate the activity
of antimicrobial agents in the absence of cycloheximide which provides a
more clinically relevant intracellular milieu. For example, any normally
operating, energy-dependent host cell membrane pumps which might move
antimicrobial agents in or out of the cell are inactivated by the use of
cycloheximide. The methods described herein are unique because they utilize
culture medium which has previously been inactivated. The methods are also
unique because they measure the effect of a prolonged duration of exposure
to the antimicrobial agent(s) after the intracellular infection by
chlamydiae has become established. Finally, the method is unique because it
measures the presence/absence of chlamydial DNA as the endpoint, for example
by measuring PCR signal. By using complete eradication of chlamydial DNA as
an endpoint, the susceptibility test confirms that all phases of Chlamydiae
have been eradicated as opposed to there having been merely a temporary halt
in replication.
When a nucleic acid amplification methodology, such as PCR, is used to
evaluate assay endpoint, the nucleic acid assay (e.g., PCR) method can be
enhanced by the unique application of a reducing agent, such as
dithiothreitol (DTT), in order to perturb the coat of chlamydial EBs and
hence allow exposure of the DNA by the action of a protein digestive
compound, such as proteinase K. In other words, the reducing agent permits
the EB coating to rupture. By using an assay for DNA in which EBs are
specifically uncoated, the susceptibility test endpoint assesses the
presence or absence of EBs as well as the presence or absence of both
replicating and nonreplicating RBs. Thus, this approach for chlamydial
susceptibility testing allows quantitative antimicrobial susceptibility
assays of single and combination agents in which the cumulative effect of
the agent(s) on the complete eradication of all life phases is measured.
Examples of results obtained with this in vitro method are described below.
In one embodiment, a suitable nucleic acid assay for identifying agents
effective against the cryptic form of Chlamydia comprises, in the presence
of agent(s) to be tested, subjecting cultured cells to reducing agent (e.g.,
dithiotreitol) and protease digestion or guanidine isothiocyanate (also
known as guanidine thiocyanate) for a prescribed period of time; extracting
DNA from the treated solution; exposing DNA to appropriate polymerase, dNTPs
and primers for DNA amplification of MOMP or other protein of the Chlamydia
species; and determining the presence or absence of amplified DNA by
visualizing the ethidium bromide treated DNA product by gel electrophoresis,
for example, or alternatively by Southern Blot. In particular embodiments,
the Chlamydia species is C. pneumoniae and the appropriate primers are
CHLMOMPDB2 and CHLMOMPCB2.
The invention further relates to a method of identifying cells containing a
non-EB cryptic form of a Chlamydia species by a nucleic acid amplification
technique (e.g., PCR) comprising subjecting cultured cells to protease
digestion; stopping protease activity; exposing cells to appropriate
heat-stable DNA polymerase, dNTPs and labeled primers (e.g., 3'-biotin
labeled, 5'-biotin labeled) for amplification of DNA encoding MOMP of the
Chlamydia species; washing the cells; exposing the cells to a reporter
molecule (e.g., strepavidin-conjugated signal enzyme); exposing the cells to
an appropriate substrate for the reporter molecule (e.g., conjugated
enzyme); and visualizing the amplified DNA encoding MOMP by visualizing the
product of the reaction.
The invention pertains to a method of identifying cells containing a cryptic
form of Chlamydia. The method comprises treating cultured cells, thought to
be infected with Chlamydia, with a disulfide reducing agent; subjecting
cultured cells to protease digestion; exposing cells to appropriate
polymerase, dNTPs and primers for DNA amplification of nucleic acid encoding
of a chlamydial protein; exposing the cells to a reporter molecule enzyme;
exposing the cells to an appropriate substrate for the reporter enzyme; and
determining the presence of a cryptic form of Chlamydia by visualizing the
amplified DNA encoding a chlamydial protein. Preferably, the amplification
technique is PCR and the primers are CHLMOMPDB2 and CHLMOMPCB2 of Chlamydia
pneumoniae.
A similar method can be used as an assay for identifying an agent which is
effective against a cryptic form of Chlamydia. Accordingly, the method
comprises treating cultured cells grown in the absence of cycloheximide,
thought to be infected with Chlamydia, with a disulfide reducing agent;
allowing the Chlamydia to replicate; adding a test agent; subjecting
cultured cells to protease digestion; exposing cells to appropriate
polymerase, dNTPs and primers for DNA amplification of a gene encoding
chlamydial protein; exposing the cells to a reporter molecule enzyme;
exposing the cells to an appropriate substrate for the reporter enzyme; and
determining the presence of cryptic form of Chlamydia by visualizing the
amplified DNA encoding a chlamydial protein, such as MOMP.
B. In Vivo Methodology
In another aspect of the invention. the susceptibility test can be used to
evaluate the status of a human or animal undergoing therapy for the
management of Chlamydia infection. For example, a biological material is
isolated from the human or animal to undergo combination therapy. The
biological material is treated such that the Chlamydia is isolated therefrom.
This chlamydial isolate is allowed to infect Chlamydia free cells. These
infected cells are then exposed to the combination of agents being used in
the individual undergoing combination therapy. Alternatively, the
individual's serum containing the antimicrobial agents can be added to the
infected cells as a "serum bactericidal test" for intracellular chlamydial
infection. The presence of chlamydial DNA is then measured.
The in vivo method uses the murine model although other animals such as rats
or rabbits can be used. In this method, mice (or any other animal) are
inoculated intranasally with 2x105 chlamydial EBs per ml. The
inventors have confirmed the work of Yang and colleagues (J. Infect. Dis.,
171:736-738 (1995)) in which intranasal inoculation of chlamydial EBs
results in systemic dissemination and, in particular, causes infection of
the spleen. The inventors have discovered that this systemic dissemination
also results in the presence of EBs in the blood of the mice. Therefore,
infectivity can be measured by blood culture or by serum/whole blood PCR for
chlamydial DNA. Systemic infection is also confirmed and monitored by the
presence of elevated IgM and IgG antibody titers. After the systemic murine
infection has been established, antimicrobial agents are given to the mice.
This is most easily done by adding the antibiotics to the drinking water.
The effect of antichlamydial therapy is monitored by serum/whole blood PCR.
When the serum/PCR assay suggests eradication of chlamydiae from the
bloodstream, the mice are sacrificed and PCR for chlamydial DNA is done on
lung, heart, liver, and spleen homogenates. This method is unique because it
measures the complete eradication of all life forms of chlamydiae in known
murine target organs for chlamydial infection. This in vivo susceptibility
method has revealed, for example, that antimicrobial therapy with the triple
agents, INH, metronidazole and penicillamine, can completely eradicate C.
pneumoniae from infected mice in four months. Moreover, following complete
eradication of chlamydiae, multiple attempts to reinfect these cured mice
via intranasal inoculation have proven unsuccessful. This suggests that
effective management and complete eradiaction results in the development of
protective immunity, and that effective management is therefore a way to
create effective immunity.
Performing PCR for chlamydial DNA on homogenates of other organ systems can
be used to determine the effectiveness of particular antibiotic combinations
in eradicating chlamydial infection in those organ systems. Establishment of
prior chiamydial infection of those systems can be done by either biopsy or
antibody-enhanced radiological imaging. Alternatively, prior infection can
be determined statistically by performing PCR for chlamydial DNA on
homogenates of the same organ systems in a similarly inoculated but
untreated control population. Organ-specific susceptibility is determined by
comparing rates of positive PCR assays in the control and treated
populations.
An alternative or complementary method of determining the presence of
cryptic chlamydial infections in an animal or cell culture is to expose the
culture to chlamydia-stimulating compounds. Such compounds include (but are
not limited to) cycloheximide, corticosteriods (such as prednisone) and
other compounds which are known to stimulate reactivation of cryptic
intracellular infections, and disulfide reducing agents (such as
dithiotreitol) and other chemicals which cause EBs to turn into RBs. Once
the cryptic forms have entered a more active phase, they can be detected
using standard detection techniques such as visual detection of inclusion
bodies, immunochemical detection of chlamydial antigen, or reverse
transcriptase-PCR.
Antichlamydial Therapy Directed Toward the Initial Stage of Chlamydia
Infection
A number of effective agents that are specifically directed toward the
initial phase of chlamydial infection (i.e., transition of the chlamydial EB
to an RB) have been identified. This "cryptic" growth phase, unlike that of
the replicating chlamydial microorganism, which uses host cell energy,
involves electrons and electron transfer proteins, as well as
nitroreductases. Based upon this, it has been discovered that the initial
phase of Chlamydia infection is susceptible to the antimicrobial effects of
nitroimidazoles, nitrofurans and other agents directed against anaerobic
metabolism in bacteria.
Nitroimidazoles and nitrofurans are synthetic antimicrobial agents that are
grouped together because both are nitro (NO2 --) containing ringed
structures and have similar antimicrobial effects. These effects require
degradation of the agent within the microbial cell such that electrophilic
radicals are formed. These reactive electophilic intermediates then damage
nucleophilic protein sites including ribosomes, DNA and RNA. Nitroimidazoles
and nitrofurans currently are not considered to possess antimicrobial
activity against members of the Chlamydia species. This lack of
antimicrobial activity, however, is due to the fact that conventional
susceptibility testing methods only test for effect on the replicating form
of Chlamydia species.
Examples of suitable nitroimidazoles include, but are not limited to,
metronidazole, tinidazole, bamnidazole, benznidazole, flunidazole,
ipronidazole, misonidazole, moxnidazole, ronidazole, sulnidazole, and their
metabolites, analogs and derivatives thereof. Metronidazole is most
preferred. Examples of nitrofurans that can be used include, but are not
limited to, nitrofurantoin, nitrofurazone, nifuirtimox, nifuratel,
nifuradene, nifurdazil, nifurpirinol, nifuratrone, furazolidone, and their
metabolites, analogs and derivatives thereof. Nitrofurantoin is preferred
within the class of nitrofurans.
Throughout this application and for purposes of this invention,
"metabolites") are intended to embrace products of cellular metabolism of a
drug in the host (e.g., human or animal) including, but not limited to, the
activated forms of prodrugs. The terms "analogs" and "derivatives" are
intended to embrace isomers, optically active compounds and any chemical or
physical modification of an agent, such that the modification results in an
agent having similar or increased, but not significantly decreased,
effectiveness against Chlamydia, compared to the effectiveness of the parent
agent from which the analog or derivative is obtained. This comparison can
be ascertained using the susceptability tests described herein.
Cells to be treated can already be cryptically infected or they can be
subjected to stringent metabolic or environmental conditions which cause or
induce the replicating phase to enter the cryptic phase. Such stringent
conditions can include changing environmental/culturing conditions in the
instance where the infected cells are exposed to .gamma.-interferon; or by
exposing cells to conventional antimicrobial agents (such as macrolides and
tetracyclines) which induce this cryptic phase of chlamydial infection in
human host cells.
Novel Antichlamydial Therapy Directed Toward the Replicating and Cryptic
Stationary Phases of Chlamydia Infection
A unique class of antichlarnydial agents that is effective against the
replicating and cryptic stationary phases of Chlamydia (and possibly against
some other stages of the cryptic phase) have been identified using the
susceptibility tests described herein. This novel class of agents comprises
ethambutol and isonicotinic acid congeners which include isoniazid (INH),
isonicotinic acid (also known as niacin), nicotinic acid, pyrazinamide,
ethionamide, and aconiazide; where INH is most preferred. Although these are
currently considered effective only for mycobacterial infections, due in
part to currently available susceptability testing methodologies, it has
been discovered that these agents, in combination with other antibiotics,
are particularly effective against Chlamydia. It is believed that the
isonicotinic acid congeners target the constitutive production of catalase
and peroxidase, which is a characteristic of microorganisms, such as
mycobacteria, that infect monocytes and macrophages. Chlamydia can also
successfully infect monocytes and macrophages.
Using INH to eradicate Chlamydia from macrophages and monocytes subsequently
assists these cells in their role of fighting infection. However, these
agents appear to be less effective, in vitro, against the cryptic phase.
Thus, ethambutol, INH and other isonicotinic acid congeners ideally should
be used in combination with agents that target other phases of the
chlamydial life cycle. These isonicotinic acid congeners are nevertheless
excellent agents for the long term therapy of chronic/systemic chlamydial
infection generally, and in particular to chiamydial infection of
endothelial and smooth muscle cells in human blood vessels.
INH and its congeners can be used to clear infection from monocytes and/or
macrophages. When monocytes and macrophages are infected by Chlamydia, they
become debilitated and cannot properly or effectively fight infection. It is
believed that, if the chlamydial infection, per se, is cleared from these
cells, then the monocytes and macrophages can resume their critical roles
fighting chlamydial or other infection(s). Thus, patient responsiveness to
combination therapy can be optimized by the inclusion of isonicotinic acid
congeners. Accordingly, one aspect of the invention provides a specific
method for reempowering monocytes or macrophages that have been compromised
by a Chlamydia infection and, in turn, comprise treating the infection in
other sites. Such compromised macrophages or monocytes can be activated by
treating the chlamydial infection by contacting the infected macrophages
and/or monocytes with an antichlamydial agent.
Therapy Directed Toward Elementary Bodies of Chlamydia
As discussed above, it has been discovered that adverse conditions, such as
limited nutrients, antimicrobial agents, and the host immune response,
produce a stringent response in Chlamydia. Such adverse conditions are known
to induce stringent responses in other microorganisms (C. W. Stratton, In:
Antibiotics in Laboratory Medicine, Fourth Edition. Lorian V (ed) Williams &
Wilkins, Baltimore, pp 579-603 (1996)) and not surprisingly induce a
stringent response in Chlamydia. This stringent response in Chlamydia alters
the morphological state of the intracellular microorganism and creates
dormant forms, including the intracellular EB, which then can cryptically
persist until its developmental cycle is reactivated. Conversely, the host
cell may lyse and allow the EBs to reach the extracellular milieu. Thus, it
is necessary to utilize a combination of agents directed toward the various
life stages of Chlamydia and, in particular, against the elementary body for
successful management of infection.
During the unique chlamydial life cycle, it is known that
metabolically-inactive spore-like EBs are released into the extracellular
milieu. Although these released EBs are infectious, they may not immediately
infect nearby susceptible host cells until appropriate conditions for EB
infectivity are present. The result of this delay in infection is the
extracellular accumulation of metabolically-inactive, yet infectious, EBs.
This produces a second type of chlamydial persistance referred to herein as
EB "tissue/blood load"). This term is similar in concept to HIV load and is
defined herein as the number of infectious EBs that reside in the
extracellular milieu. Direct microscopic visualization techniques, tissue
cell cultures, and polymerase chain reaction test methods have demonstrated
that infectious EBs are frequently found in the blood of apparently healthy
humans and animals. This phenomenon is clearly of great clinical importance
in chlamydial infections as these metabolically-inactive EBs escape the
action of current antichlamydial therapy which is directed only against the
replicating intracellular forms of Chlamydia. The presence of infectious
extracellular EBs after the completion of short term. anti-replicating phase
therapy for chlamydial infections has been shown to result in intracellular
infection relapse. Thus, the duration and nature of antichlamydial therapy
required for management of chlamydial infections is, in part, dictated by
the extracellular load of EBs. For purposes of this invention, short term
therapy can be approximately two to three weeks; long term therapy in
contrast is for multiple months.
As described in previous sections. it is also believed that persistance of
chlamydial infections, in part, may be due to the presence of cryptic forms
of Chlamydia within the cells. This cryptic intracellular chlamydial form
apparently can be activated by certain host factors such as cortisone (Yang
et al., Infection and Immunity, 39:655-658 (1983); and Malinverni et al.,
The Journal of Infectious Diseases, 172:593-594 (1995)). Antichlamydial
therapy for chronic Chlamydia infections must be continued until any
intracellular EBs or other intracellular cryptic forms have been activated
and extracellular EBs have infected host cells. This reactivation/reinfection
by chlamydial EBs clearly is undesirable as it prolongs the therapy of
chlamydial infections, as well as increases the opportunity for
antimicrobial resistance to occur.
Physiochemical agents have been identified that can inactivate chlamydial
EBs in their respective hosts by reducing disulfide bonds which maintain the
integrity of the outer membrane proteins of the EBs. For Chlamydia,
disruption of the outer membrane proteins of EBs thereby initiates the
transition of the EB form to the RB form. When this occurs in the acellular
milieu where there is no available energy source, the nascent RB perishes or
falls victim to the immune system. Thus, disulfide reducing agents that can
interfere with this process are suitable as compounds for eliminating EBs.
One such class of disulfide reducing agents are thiol-disulfide exchange
agents. Examples of these include, but are not limited to,
2,3-dimercaptosuccinic acid (DMSA; also referred to herein as "succimer");
D,L,-.beta.,.beta.-dimethylcysteine (also known as penicillamine); .beta.-lactam
agents (e.g., penicillins, penicillin G, ampicillin and amoxicillin, which
produce penicillamine as a degradation product), cycloserine, dithiotreitol,
mercaptoethylamine (e.g., mesna, cysteiamine, dimercaptol), N-acetylcysteine,
tiopronin, and glutathione. A particularly effective extracellular
antichlamydial agent within this class is DMSA which is a chelating agent
having four ionizable hydrogens and two highly charged carboxyl groups which
prevent its relative passage through human cell membranes. DMSA thus remains
in the extracellular fluid where it can readily encounter extracellular EBs.
The two thiol (sulfhydryl) groups on the succimer molecule (DMSA) are able
to reduce disulfide bonds in the MOMP of EBs located in the extracellular
milieu.
Penicillamine can also be used as a disulfide reducing agent to eliminate
chlamydial EBs. However, the use of penicillamine may cause undesirable side
effects. Thus, as an alternative, those .beta.-lactam agents which are
metabolized or otherwise converted to penicillamine-like agents in vivo
(i.e., these agents possess a reducing group) can be orally administered to
the human or animal as a means of providing a controlled release of
derivative penicillamine, by non-enzymatic acid hydrolysis of the
penicillin, under physiologic conditions. Clavulonic acid is not required
for this hydrolysis or for using .beta.-lactam agents to create
penicillamine in vivo.
Currently Recognized Agents Active Against Chlamydia Replication
As chlamydial RBs transform into EBs, they begin to utilize active
transcription of chlamydial DNA and translation of the resulting mRNA. As
such, these forms of Chlamydia are susceptible to currently used
antimicrobial agents. The antichlamydial effectiveness of these agents can
be significantly improved by using them in combination with other agents
directed at different stages of Chlamydia life cycle, as discussed herein.
Classes of suitable antimicrobial agents include, but are not limited to,
rifamycins (also known as ansamacrolides), quinolones, fluoroquinolones,
chloramphenicol, sulfonamides/sulfides, azalides, cycloserine, macrolides
and tetracyclines. Examples of these agents which arc members of these
classes, as well as those which are preferred, are illustrated below in
Table 5.
TABLE 5
Agents Effective Against the Replicating
Phase of Chlamydia
Drug Class Examples Preferred
Quinolones/ Ofloxacin Levofloxacin
Fluoroquinolones Levofloxacin
Trovafloxacin
Sparfloxacin
Norfloxacin
Lomefloxacin
Cinoxacin
Enoxacin
Nalidixic Acid
Fleroxacin
Ciprofloxacin
Sulfonamides Sulfamethoxazole Sulfamethoxazole/
Trimethoprim
Azalides Azithromycin Azithromycin
Macrolides Erythromycin Clarithromycin
Clarithromycin
Lincosamides Lincomycin
Clindamycin
Tetracyclines Tetracycline Minocycline
Doxycycline
Minocycline
Methacycline
Oxytetracyline
Rifamycins Rifampin Rifampin
(Ansamacrolides) Rifabutin
All members of the Chlamydia species, including C. pneumoniae, are
considered to be inhibited, and some killed, by the use of a single agent
selected from currently used antimicrobial agents such as those described
above. However, using the new susceptability test, the inventors have found
complete eradication of Chlamydia cannot be achieved by the use of any one
of these agents alone because none are efficacious against all phases of the
Chlamydia life cycle and appear to induce a stringent response in Chlamydia
causing the replicating phase to transform into cryptic forms. This results
in a persistent infection in vivo or in vitro that can be demonstrated by
PCR techniques which assess the presence or absence of chlamydial DNA.
Nevertheless, one or more of these currently used agents, or a new agent
directed against the replicating phase of Chlamydia, should be included as
one of the chlamydial agents in a combination therapy in order to slow or
halt the transition of the EB to the RB as well as to inhibit chlamydial
replication.
Methodology for Selecting Potential Agent Combinations
In attempting to manage or eradicate a systemic infection, it is critical to
target multiple phases in the life cycle of Chlamydia, otherwise viable
Chlamydia in the untargeted phases will remain after therapy and result in
continued, chronic infection. This fundamental insight is at the core of
this invention.
A preferred method for selecting an appropriate combination of agents that
satisfies the requirements of this strategy comprises a plurality of steps
as follows:
1. Identify the phases of the chlamydial life cycle. For example, the
following phases are currently known:
a. Elementary Body ("EB")--Extracellular or Intracellular. Intracellular EBs
may represent a type of "cryptic phase".
b. EB to Reticulate Body ("RB") transition phase.
c. Stationary RB phase. This is what is traditionally thought of as the
"cryptic phase".
d. Replicating RB phase.
e. RB to EB transition phase (also called "condensation").
2. Evaluate the relative importance of targeting each particular phase in
eradicating reservoirs of Chlamydia from the host organism. For example, the
life-cycle stages listed in step 1 can be prioritized based on the following
assumptions:
a. In the host, Extracellular and intracellular EBs represent a very
important reservoir of infectious agents that result in chronic and and
persistent infection.
b. Most intracellular RBs in chronic infections are non-replicating. The 3-4
day reproduction cycle seen in cycloheximide-treated eukaryotic cells is an
artifact of an atypical, cell culture environment designed primarily to
propagate Chlamydia.
c. The transition phases represent only a small portion of Chlamydia in
chronic infections.
3. Identify "targets" for each phase of the selected life cycle phases. A
target is an attribute of Chlamydia which is vulnerable during a particular
life cycle phase. For example, the disulfide bonds in MOMP are a target
during the EB phase.
4. Identify agents with known or theoretical mechanism(s) of action against
those targets.
5. Estimate whether those agents would be merely inhibitory or, preferably,
cidal, through an understanding of their mechanism of action.
6. Confirm the estimate by using the following approaches:
a. In the case of anti-EB agents, treat EBs with the agent, then attempt to
infect cells with the treated EBs. If the cells do not become infected, the
agent is EB-cidal.
b. In the case of other agents, use the susceptibility tests disclosed
elsewhere herein, to determine whether the agent, either alone or in
combination with other agents, is chlamydicidal.
7. Select a combination of agents that, through their individual effects,
provide activity against targets for the most important phases within the
chlamydial life cycle. Preferably, a combination should target as many
phases of the life cycle as possible, seeking to maximize the total of the
relative important scores of the phases targeted while minimizing the number
of drugs involved.
8. Test the combination using the susceptibility testing procedures
described elsewhere. This step is necessary because the selected combination
may or may not be chlamydicidal for various reasons such as intracellular
penetration and/or efflux.
9. Set initial dosages based on clinical standards which consider the
pharmacokenetics and pharmacodynamics for the drugs prescribed individually;
modifications, if needed, are based on results of susceptibility testing and
in vivo efficacy.
Table 6 provides an example of how the foregoing methodology can be used.
The preferred embodiment includes agents which:
a) Target disulfide bonds in the EB and condensation phases;
b) Target non-oxidative metabolism in the stationary/cryptic phase;
c) Target constitutive production of peroxidases and catalyses in the
stationary and replicative phases;
d) In the latter two cases, work through physio-chemical disruption of the
organism through free radicals, which are very difficult for organism to
develop resistance to; and
e) Optionally adds an agent to target DNA-dependent RNA polymerase in the
EB.fwdarw.RB phase.
The foregoing methodology for selecting combination therapies can be
automated (e.g., by a computer system) at one or a combination of the steps
described above. This methodology is applicable even after greater
understanding of the chlamydial life cycle leads to a re-prioritization or
even sub-division of the life-cycle phases, new theoretical targets within
Chlarnydia are identified, or new drugs are developed which attack currently
known or new targets within Chlamydia. For example, the phases of the life
cycle could be further sub-classified based on the type of host cell the
phase is in. Thus, stationary phase RBs in macrophages could be considered a
separate phase than stationary phase RBs in hepatocytes. This allows the
methodology to be used to design a single or multi-tissue specific
combination of agents.
TABLE 6
Example of using Theoretical Effect on Various Targets within the
Chlamydialc Life Cycle to Pick a Combination Therapy
Potentially Constituitive
DNA- Ribosomes
vulnerable production of
dependent involved in
attributes of Disulfide Non-oxidative peroxidases and
RNA Folic acid protein
Chlamydia: bonds metabolism catalyses
Topoisomerases polymerase pathway synthesis . . .
Relative
Phase in Chlamydial
Impor-
Life Cycle Theoretical Targets
tance
EB (Extracellular or X
8
Intracellular)
EB->RB Transition p p
X 6
Stationary Phase RB X X p
p p p 8
("Cryptic phase")
Replicating RB p X X
p X X 7
RB->EB Transition X p p
6
("Condensation")
Pharmaceutical
Compounds
Non-Novel Classes Quinolones,
Rifamycins Sulfona- Azalides,
Fluroquinolones mides Macrolides,
Lincosamides,
Tetracyclines
Novel Classes Disulfide Agents that strip Agents activated
reducing agents electrons from by peroxidases
carrier proteins and catalyses to
and become free- become free-
radicals radicals
Examples: Thiol-disulfide Nitroimidazoles Isonicotinic acid
reducing agents & Nitrofurans cogeners
Drugs of Choice Penicillamine Metronidazole or INH
Levofloxacin Rifampin Sulfa- Azythromycin
(based on (from Nitrofurantoin
Trovafloxavin methoxizole/ Clarithromycin
effectiveness) Amoxicillan)
trimethoprim Minocycline
Preferred Penicillamine Metronidazole INH
.+-.Rifampin
Embodiment (Amoxicillan)
X = known target relevant to that life phase;
p = possible target relevant to that life phase
Diseases Associated with Chlamydial Infection
An association has been discovered between chronic Chlamydia infection of
body fluids and/or tissues with several disease syndromes of previously
unknown etiology in humans which respond to unique antichlamydial regimens
described herein. To date, these diseases include Multiple Sclerosis (MS),
Rheumatoid Arthritis (RA), Inflammatory Bowel Disease (IBD), Interstitial
Cystitis (IC), Fibromyalgia (FM), Autonomic nervous dysfunction (AND,
neural-mediated hypotension); Pyoderma Gangrenosum (PG), Chronic Fatigue
(CF) and Chronic Fatigue Syndrome (CFS). Other diseases are under
investigation. Correlation between Chlamydia infection and these diseases
has only recently been established as a result of the diagnostic
methodologies and combination therapies described herein.
Based on this evidence, published evidence of an association between
atherosclerosis and Chlamydia (Grupta el al, Circulation 96:404-407 (1997)),
and an understanding of the impact Chlamydia infections have on infected
cells and the immune systems, the inventors have discovered a connection
between Chlamydia and a broad set of inflammatory, autoimmune, and immune
deficiency diseases. Thus, the invention describes methods for diagnosing
and/or treating disease associated with Chlamydia infection, such as
autoimmune diseases, inflammatory diseases and diseases that occur in
immunocompromised individuals by diagnosing and/or treating the Chlamydia
infection in an individual in need thereof, using any of the assays or
therapies described herein. Progress of the treatment can be evaluated
serologically, to determine the presence or absence of Chlamydia using for
example the diagnostic methods provided herein. and this value can be
compared to serological values taken earlier in the therapy. Physical
improvement in the conditions and symptoms typically associated with the
disease to be treated should also be evaluated. Based upon these evaluating
factors, the physician can maintain or modify the antichlamydial therapy
accordingly. For example, the physician may change an agent due to adverse
side-effects caused by the agent, ineffectiveness of the agent, or for other
reason. When antibody titers rise during treatment then alternate compounds
should be substituted in order to achieve the lower antibody titers that
demonstrate specific susceptability of the Chlamydia to the new regimen. A
replacement or substitution of one agent with another agent that is
effective against the same life stage of Chlamydia is desirable.
The therapies described herein can thus be used for the treatment of acute
and chronic immune and autoimmune diseases when patients are demonstrated to
have a Chlamydia load by the diagnostic procedures described herein which
diseases include, but are not limited to, chronic hepatitis, systemic lupus
erythematosus, arthritis, thyroidosis, scleroderma, diabetes mellitus,
Graves' disease, Beschet's disease and graft versus host disease (graft
rejection). The therapies of this invention can also be used to treat any
disorders in which a chlamydial species is a factor or co-factor.
Thus, the present invention can be used to treat a range of disorders in
addition to the above immune and autoimmune diseases when demonstrated to be
associated with chlamydial infection by the diagnostic procedures described
herein; for example, various infections, many of which produce inflammation
as primary or secondary symptoms, including, but not limited to, sepsis
syndrome, cachexia, circulatory collapse and shock resulting from acute or
chronic bacterial infection, acute and chronic parasitic and/or infectious
diseases from bacterial, viral or fungal sources, such as a HIV, AIDS
(including symptoms of cachexia, autoimmune disorders, AIDS dementia complex
and infections) can be treated, as well as Wegners Granulomatosis.
Among the various inflammatory diseases, there are certain features of the
inflammatory process that are generally agreed to be characteristic. These
include fenestration of the microvasculature, leakage of the elements of
blood into the interstitial spaces, and migration of leukocytes into the
inflamed tissue. On a macroscopic level, this is usually accompanied by the
familiar clinical signs of erythema, edema, tenderness (hyperalgesia), and
pain. Inflammatory diseases, such as chronic inflammatory pathologies and
vascular inflammatory pathologies, including chronic inflammatory
pathologies such as aneurysms, hemorrhoids, sarcoidosis, chronic
inflammatory bowel disease, ulcerative colitis, and Crohn's disease and
vascular inflammatory pathologies, such as, but not limited to, disseminated
intravascular coagulation, atherosclerosis, and Kawasaki's pathology are
also suitable for treatment by methods described herein. The invention can
also be used to treat inflammatory diseases such as coronary artery disease,
hypertension, stroke, asthma, chronic hepatitis, multiple sclerosis,
peripheral neuropathy, chronic or recurrent sore throat, laryngitis,
tracheobronchitis. chronic vascular headaches (including migraines, cluster
headaches and tension headaches) and pneumonia when demonstrated to be
pathogenically related to Chlamydia infection.
Treatable disorders when associated with Chlamydia infection also include,
but are not limited to, neurodegenerative diseases, including, but not
limited to, demyelinating diseases, such as multiple sclerosis and acute
transverse myelitis; extrapyramidal and cerebellar disorders, such as
lesions of the corticospinal system; disorders of the basal ganglia or
cerebellar disorders; hyperkinetic movement disorders such as Huntington's
Chorea and senile chorea; drug-induced movement disorders, such as those
induced by drugs which block CNS dopamine receptors; hypokinetic movement
disorders, such as Parkinson's disease; Progressive supranucleo palsy;
Cerebellar and Spinocerebellar Disorders, such as astructural lesions of the
cerebellum; spinocerebellar degenerations (spinal ataxia, Friedreich's
ataxia, cerebellar cortical degenerations. multiple systems degenerations (Mencel,
Dejerine-Thomas, Shi-Drager, and Machado Joseph)); and systemic disorders (Refsum's
disease, abetalipoprotemia, ataxia, telangiectasia, and mitochondrial
multi-system disorder); demyelinating core disorders, such as multiple
sclerosis, acute transverse myelitis; disorders of the motor unit, such as
neurogenic muscular atrophies (anterior horn cell degeneration, such as
amyotrophic lateral sclerosis, infantile spinal muscular atrophy and
juvenile spinal muscular atrophy); Alzheimer's disease; Down's Syndrome in
middle age; Diffuse Lewy body disease; Senile Dementia of Lewy body type;
Wernicke-Korsakoff syndrome; chronic alcoholism; Creutzfeldt-Jakob disease;
Subacute sclerosing panencephalitis, Hallerrorden-Spatz disease; and
Dementia pugilistica, or any subset thereof.
It is also recognized that malignant pathologies involving tumors or other
malignancies, such as, but not limited to leukemias (acute, chronic
myelocytic, chronic lymphocytic and/or myelodyspastic syndrome); lymphomas
(Hodgkin's and non-Hodgkin's lymphomas, such as malignant lymphomas (Burkitt's
lymphoma or Mycosis fungoides)); carcinomas (such as colon carcinoma) and
metastases thereof; cancer-related angiogenesis; infantile hemangiomas;
alcohol-induced hepatitis. Ocular neovascularization, psoriasis, duodenal
ulcers, angiogenesis of the female reproductive tract, can also be treated
when demonstrated by the diagnostic procedures described herein to be
associated with Chlamydial infection.
An immunocompromised individual is generally defined as a person who
exhibits an attenuated or reduced ability to mount a normal cellular or
humoral defense to challenge by infectious agents, e.g., viruses, bacterial,
fungi and protozoa. Persons considered immunocompromised include
malnourished patients, patients undergoing surgery and bone narrow
transplants, patients underoing chemotherapy or radiotherapy, neutropenic
patients, HIV-infected patients, trauma patients, burn patients, patients
with chronic or resistant infections such as those resulting from
myeloodysplastic syndrome, and the elderly, all of who may have weakened
immune systems. A protein malnourished individual is generally defined as a
person who has a serum albumin level of less than about 3.2 grams per
deciliter (g/dl) and/or unintentional weight loss greater than 10% of usual
body weight.
The course of therapy, serological results and clinical improvements from
compassionate antichlamydial therapy in patients diagnosed with the diseases
indicated were observed and are reported in Example 5. The data provides
evidence to establish that treatment of Chlamydia infection results in the
serological and physical improvement of a disease state in the patient
undergoing combination therapy. These observations were consistent among a
variety of different diseases which fall within a generalized disease class.
Other Diseases of Unknown Etiology with New Evidence for a Chlamydia
Pneumoniae Etiology
Both C. trachomatis and C. psittaci exhibit a protean disease complex
dependent on different serovars. One known basis for this diversity to date
is the amino acid sequence of the MOMP. FIG. 1 shows a sequence alignment of
various Chlamydia MOMPs. Note that the size and sequence are relatively
homologous except for the four variable regions that are responsible for the
serovar (serotype) basis of classification. Further, it has been discovered
that C. pneumoniae infects blood vessel endothelial cells from which EBs are
released in the blood stream. In addition, macrophages are known targets for
C. pneumoniae and may serve as reservoirs and provide an additional
mechanism of transmission. C. pneumoniae is thus able to spread throughout
the human body, establishing infection in multiple sites and in multiple
organ systems. Infected sites may exist for an extended period without
inducing symptoms that are noticed by the patient or by an examining
physician. Sequence variability of MOMPs or other chlamydial antigens may
provide a basis for organ specificity while other chlamydial proteins, such
as the 60K and 70K heat shock proteins or LPS, may influence immune
response.
C. psittaci and C. pecorum are known to cause a host of infections in
economically significant animals. Thus, the teachings of this invention are
relevant to animals. Throughout this application and for purposes of this
invention, "patient" is intended to embrace both humans and animals.
Virtually all rabbits and mice tested to date have PCR signals for C.
pneumoniae. They can be used as appropriate animal models for treatment
using specific combination antibiotics to improve therapy. (Banks et al.,
Ameri. J. of Obstetrics and Gynecology 138(7Pt2):952-956 (1980)); (Moazed et
al., Am. J. Pathol. 148(2):667-676 (1996)); (Masson et al., Antimicrob.
Agents Chemother. 39(9):1959-1964 (1995)); (Patton et al., Antimicrob.
Agents Chemother. 37(1):8-13 (1993)); (Stephens et al., Infect. Immun.
35(2):680-684 (1982)); and (Fong et al., J. Clin. Microbiol. 35(1):48-52
(1997)).
Coupled with these developments are the recently developed rabbit models of
coronary artery disease, where rabbits exposed to C. pneumoniae subsequently
develop arterial plaques similar to humans (Fong et al., J. Clin. Microbiol.
35:48-52 (1997)). Most recently, a study at St. George's Hospital in London
found that roughly 3/4 of 213 heart attach victims have significant levels
of antibodies to C. pneumoniae antibody and that those that have such
antibodies achieve significantly lower rates of further adverse cardiac
events when treated with antibiotics (Gupta et al., Circulation 95:404-407
(1997)). Taken together, these three pieces of evidence (the bacteria found
in diseased tissue, inoculation with the bacteria causes diseases, and
treating for the bacteria mitigates disease) make a case for a causal
connection.
Adjunct Agents Used in Conjunction with the Combination Therapy
In addition to the combination therapies discussed above, other compounds
can be co-administered to an individual undergoing antichiamydial therapy
for the management of chronic/systemic infection. For example, it may be
desirable to include one or a combination of anti-inflammatory agents and/or
immunosuppressive agents to amelioriate side-effects that may arise in
response to a particular antichlamydial agent, e.g., Herxheimer reactions.
Initial loading with an anti-inflammatory steroid can be introduced to
minimize side-effects of the antichlamydial therapy in those patients in
which clinical judgment suggests the possibility of serious inflammatory
sequelae.
Suitable anti-inflarnmatory agents (steroidal and nonsteroidal agents)
include, but are not limited to, Prednisone, Cortisone. Hydrocortisone and
Naproxin. Preferably the anti-inflammatory agent is a steroidal agent, such
as Prednisone. The amount and frequency of administration of these adjunct
compounds will depend upon patient health, age, clinical status and other
factors readily apparent to the medical professional.
Vitamin C (2 gms bid) has also been introduced based on the report that
Vitamin C (ascorbic acid) at moderate intracellular concentrations
stimulates replication of C. trachomatis (Wang el al., J. Clin. Micro.
30:2551-2554 (1992)) as well as its potential effect on biofilm charge and
infectivity of the bacterium and specifically the EB (Hancock, R. E. W.,
Annual Review in Microbiology, 38:237-264 (1984)).
Additionally, probenicid can optionally be added to the therapy as an
enhancer. Probenecid is known to increase plasma levels of penicillins by
blocking the uricosuric and renal tubular secretion of these drugs.
Diagnosis and Treatment of Secondary Porphyria
Chlamydia is a parasite of normal energy production in infected eukaryotic
cells. As a result, host cells have insufficient energy available for their
normal functioning. The energy shortage also causes the host cell
mitochondria to attempt to synthesize certain critical enzymes involved in
energy production in order to increase energy production. Because Chlamydia
also prevents this synthesis from completing, these enzyme's precursors,
called porphyrins, build up in cell and often escape into the intracellular
mileau. Porphyrins readily form free-radicals. that, in turn, damage cells.
Thus, there is an obligate secondary porphyria that accompanies many
chiamydial infections. Therapy for this secondary porphyria, which is
adjunct to anti-chlamydial therapy, involves at least three strategies: a)
supplement the cellular energy supply to mitigate cell malfunction and the
formation of porphyrins; b) reduce the levels of systemic porphyrins; and c)
mitigate the harmful effects of the porphyrins.
The pathogenesis of chronic/systemic chlamydial infection is unique in that
the intracellular infection by this parasite results in a number of
heretofore unrecognized concomitant and obligatory metabolic/autoimmune
disorders including secondary porphyria with associated autoantibodies
against the porphyrins. Cross reaction with Vitamin B12 can result in a
subclinical autoimmune-mediated Vitamin B12 deficiency. These associated
disorders often require diagnosis and preventive and/or specific adjunctive
therapy.
The first of these concomitant disorders is a porphyria which is a direct
result of the chlamydial infection of host cells. This form of porphyria is
a secondary porphyria as it is not the result of a genetic deficiency of the
enzymes involved in the biosynthesis of heme. Based upon the discovery of
this secondary form of porphyria, a unique approach for the diagnosis and
treatment of obligatory and secondary disorders caused by Chlamydia
infections has been developed. The adjunctive therapy described herein can
be used in combination with the appropriate antimicrobial therapy required
for eradication of the pathogen. This adjunctive therapy for secondary
porphyria is particularly important for long-term antimicrobial therapy of
chronic/systemic infections as such therapy often evokes symptoms of
secondary porphyria.
The discussion below outlines the believed mechanism by which Chlamydiae
induce these secondary metabolic disorders. The phrase "chlamydial-induced
porphyria" is defined herein as an obligatory and secondary metabolic
disorder which is the direct result of a chlamydial infection and which may
find clincially relevant phenotypic expression requiring interventional
therapy.
Chlamydiae are prokaryocytes that develop in eukaryotic cells and utilize
part of the host cell metabolism (Becker, Y., Microbiological Reviews,
42:247-306 (1978); McClairty, G., Microbiology, 2:157-164(1994)). The
transition of elementary bodies (EBs) to reticulate bodies (RBs) for
Chlamydia species requires the presence of functioning mitochondria in the
infected cell as well as the production by the host cell of nucleoside
triphosphates which are needed for chlamydial biosynthesis of nucleic acids
(Becker, Y., Microbiological Reviews, 42:247-306 (1978); McClairty, G.,
Microbiology, 2:157-164(1994); Ormsbee, R. A. and Weiss, E., Science, 2:1077
(1963); Weiss, E., Jour. of Bacteriology, 90:243-253 (1965); Weiss, E. and
Kiesow, L. A., Bacteriology Proceedings, 85 (1966); Weiss, E. and Wilson, N.
N., Jour. of Bacteriology, 97:719 (1969); Hatch et al., Jour. of
Bacteriology, 150:662-670 (1985)). Chlamydiae are known to possess fragments
of the glycolytic, pentose phosphate, and citric acid pathways and appear to
be capable of converting glucose-6-phosphate (but not glucose) to pyruvate
and pentose (Ormsbee, R. A. and Weiss, E., Science, 2:1077 (1963); Weiss, E.
and Kiesow, L. A., Bacteriology Proceedings, 85 (1966)). However, Chlamydiae
seem to lack enzymes needed for the net generation of adenosine triphosphate
(ATP)(Weiss, E., Jour. of Bacteriology, 90:243-253 (1965)). Thus. chlamydial
development is dependent on active mitochondrial and nuclear function of the
host cell. For this reason, Chlamydiae are considered obligatory
intracellular parasites (McClairty, G., Microbiology, 2:157-164(1994)).
Chlamydial dependence on host cell energy must necessarily deplete the host
cell's existing energy output at the net expense of depriving host cell
biosynthetic pathways.
The requirement of an exogenous source of ATP and the presence of a specific
ATP transport system in Chlamydiae have provided supporting evidence for the
energy parasite concept (Hatch et al., Jour. of Bacteriology, 150:662-670
(1985)). This ATP transport system is an ATP-adenosine diphosphate (ADP)
exchange mechanism (Peeling et al., Infect. and Immun., 57:3334-3344 (1989))
similar to that found in mitochondria (Penefsky, H. S. and Cross, R. L.,
Adv. Enzym. and Rel. Areas in Molec. Bio., 64:173-214 (1991)). Moreover,
electron microscopic studies have shown that replicating Chlamydiae are
always found in close proximity to mitochondria. Therefore, it has been
suggested that Chlamydiae behave in the reverse manner of mitochondria in
that mitochondria import ADP from the host cell cytoplasm and export ATP,
while Chlamydiae import ATP and export ADP (Becker, Y., Microbiological
Reviews, 42:247-306 (1978)).
The production of ATP within the mitochondria is powered by a mechanism
called chemiosmotic coupling (Kalckar, H. M., Annu. Review of Biochem.,
60:1-37 (1991); Lehninger, A. L., The Mitochondrion. Molecular Basis of
Structure and Function, The Benjamin Company, Incorporated, New York;
Slater, E. C., Europ. Journ. of Biochem., 166:489-504 (1987); Babcock, G. T.
and Wickstrom, M., Nature, 356:301-309 (1992); Senior, A. E., Physiology
Review, 68:177-231 (1988); Pedersen, P. I. and Carafoli, E., Trends in
Biochem. Sci., 12:145-150 (1987); Pedersen, P. I. and Carafoli, E., Trends
in Biochem. Sci., 12:145-150 (1987)). The citric acid cycle drives oxidation
of NADH or FADH2, which, in turn, releases a hydride ion (H-), which is
quickly converted to a proton (H+) and two high-energy electrons (2 e-). As
the high-energy electron pair is transferred to each of these three
multiprotein complexes, the protons produced pass freely from the
mitochondria matrix to the intermembrane space via channels in complexes I,
III and IV. Thus, the transfer of electrons from NADH down the electron
transport chain causes protons to be pumped out of the mitochondrial matrix
and into the intermembrane space. These protons then reenter the matrix
through a specific channel in complex V. This proton gradient across the
inner membrane results in the proton motive force which drives ATP
synthesis.
Chlamydial ATPase in essence is competing for protons with host cell
mitochondrial ATPase. This, of course, reduces the ATP produced by the
mitochondria. A net reduction of ATP in the host cell mitochondria results
in a concomitant lowering of the electron transfer in the host cell
mitochondria because electron transfer and ATP synthesis are obligatorily
coupled; neither reaction occurs without the other. The establishment of a
large electrochemical proton gradient across the inner mitochondrial
membrane halts normal electron transport and can even cause a reverse
electron flow in some sections of the host cell respiratory chain. The
reduction of electron transfer in the host cell mitochondria, in turn,
lowers the translocation and reduction of extramatrix mitochondrial ferric
iron to intramatrix ferrous iron. This energy depletion, in turn, interferes
with the biosynthesis of heme.
A. Biosynthesis of Heme
Heme is a Fe2+ complex in which the ferrous ion is held within the organic
ligand, tetrapyrrolic macrocycle. The heme-containing tetrapyrrolic
macrocyclic pigments are known as porphyrinogens and play a major role in
cellular biochemistry. A number of critical cellular functions such as
electron transport, reduction of oxygen, and hydroxylation are mediated by a
family of heme-based cytochromes including catalase, peroxidase and
superoxide dismutase. Moreover, the oxygen-carrying properties of hemoglobin
and myoglobin are based on heme. Many cellular enzymes such as cytochrome
P-450 and tryprophan pyrolase contain heme.
The biosynthesis of heme (Battersby et al., Nature, 285:17- (1980);
Batterspy, A. R., Proceedings of the Royal Society of London, 225:1-26
(1985)) is an energy-dependent process which is adversely affected by
depletion of host cell energy. The metabolic consequence of the interruption
of heme biosynthesis is porphyria (Ellefson, R. D., Mayo Clinic Proceedings,
57:454-458 (1982); Hindmarsh, J. T., Clin. Chem., 32:1255-1263 (1986); Meola,
T. and Lim, H. W., Bullous Diseases, 11:583-596 (1993); Moore, M. R., Int'l.
Journ. of Biochem., 10:1353-1368 (1993)). Heme synthesis is a series of
irreversible biochemical reactions of which some occur in the cell
mitochondria and some in the cytoplasm. The intramitochondrial reactions are
mainly oxidation-reduction while those in the cytosol are condensation and
decarboxylation.
Porphyrinogens, porphyrins and porphyria are all related to heme synthesis.
The biosynthesis of heme occurs in all human cells and involves a relatively
small number of starting materials that are condensed to formn
porphyrinogens; the porphyrins are formed from the porphyrinogens by
non-enzymatic oxidation. As porphyrinogens progress through the heme
biosynthesis pathway, the numbers of carboxyl side groups on the
corresponding porphyrins decreases, as does the water solubility of the
compounds.
The porphyrias are consequences of any impairment of the formation of
porphyrinogens or in their transformation to heme. Porphyrins are formed
from porphyrinogens by non-enzymatic oxidation. Each of the various genetic
porphyrias is linked to an enzyme deficiency in the heme biosynthesis
pathway. As a consequence of the enzyme defects, there is increased activity
of the initial and rate-controlling enzyme of this biosynthesis pathway that
results in overproduction and increased excretion of porphyrinogen
precursors and porphyrinogens. The steps of heme biosynthesis are laid out
in Table 7.
TABLE 7
Simplified outline of enzymes and precursors
in the Biosynthesis of Heme
Other
Enzyme precursor Inhibitor Resultb
glycine and succinyl
coenzyme A
.DELTA.-ALA synthase pyridoxal heme delta-aminolevulinic
5'-phosphate acid (.DELTA.-ALA)
.DELTA.-ALA dehydratase* lead and porphobilinogen
heme (PBG)
PBG deaminase* tetrapyrrole hydroxy-
methylbilane
uroporphyrinogen-III uroporphyrinogen-IIIa
cosynthase*
uroporphyrinogen 7,6,5-carboxyl
decarboxylase* porphyrinogen-III
coproporphyrinogen coproporphyrino-
oxidase gen-III
protoporphyrinogen protoporphyrinogen
oxidase
protoporphyrinogen protoporphyrin
oxidase
ferrochelatase ferrous ion heme
a In absence of this step, the symmetric uroporphyrinogen-I is formed
b Becomes precursor of the next step
*Present in circulating red cells
When porphyrinogens accumulate due to enzymatic defects in the heme
biosynthesis pathway, they are oxidized to photosensitizing porphyrins.
Porphyrins are classified as photodynamic agents because they generally
require superoxide/oxygen/electrons to exert their damaging biologic
effects. Porphyrins may be converted from ground state to excited state
molecules after absorption of radiation. Excited state porphyrins transfer
energy to oxygen molecules and produce reactive oxygen species such as
singlet oxygen, superoxide anion, super oxide radical, hydroxyl radical and
hydrogen peroxide. Reactive oxygen species have been noted to disrupt
membrane lipids, cytochrome P-450 and DNA structure. If these reactive
oxygen species are released into the extracellular space, as seen in acute
porphyria, autooxidation of surrounding tissue may result. Thus, the
accumulation of porphyrinogens/porphyrins in human tissues and body fluids
produces a condition of chronic system overload of oxidative stress with
long term effects particularly noted for neural, hepatic and renal tissue.
B. Chlamydia and Secondary Porphyria
As mentioned, ferric/ferrous translocation is a critical step in the
biosynthesis of heme as it catalyses the oxidative entry of
coproporphyrinogen into the mitochondria matrix as protoporphyrin; Chlamydia
interfere with this step by reducing electron transfer in the host cell.
When coproporhyrinogen is unable to return to the mitochondrial matrix, it
accumulates first in the cytosol and then in the extracellular milieu.
Within the mitochondrial matrix, the final steps in the biosynthesis of heme
are halted. Because the accumulation of heme within the mitochondrial matrix
normally exerts a negative feedback on heme biosynthesis, the reduction of
heme caused by the inability of coproporphyrinogen to return to the
mitochondrial matrix results in the increased production of heme precursors
such as .DELTA.-ALA and PBG, the first and second products in heme
biosynthesis. Thus, porphyrin precursors such as .DELTA.-ALA and PBG begin
to accumulate in the mitochondrial matrix, then in the cytosol, and then in
the extracellular milieu.
Depletion of host cell energy by the intracellular infection with Chlamydia
species causes additional energy-related complications. As fewer electrons
are available to move through the electron transport chain of the host cell
mitochondrial matrix membrane, the citric acid cycle produces more
succinyl-CoA which, in turn, promotes increased synthesis of .DELTA.-ALA.
The net result is an increased amount of heme precursors which become
porphyrins. The presence of porphyrins in the mitochondrial matrix damages
the cell as these molecules are unstable and form free radicals. The high
energy electrons generated by these free radicals is "captured" by
ubiquinone and cytochrome c which are present in the mitochondrial matrix
membrane. This, of course, effectively uncouples electron transport from ATP
synthesis and "short circuits" the proton-motice force: ATP synthesis is
then reduced. Less ATP, in turn, means increased porphyrins and a
destructive cycle is begun.
The clinical result of the intracellular and extracellular accumulation of
porphyrins, if extensive, is a tissue/organ specific porphyria which
produces many of the classical manifestations of hereditary porphyria. As
the chlamydial-infected host cells lyse, as happens in the normal life cycle
of Chlamydia, the intracellular porphyrins are released and result in a
secondary porphyria. Moreover, when the chlamydial infection involves
hepatic cells, the use of any pharmacologic agents that are metabolized by
cytochrome P-450 in the liver will increase the need for cytochrome P-450,
which is a heme-based enzyme. Hence, the biosynthesis of heme in the liver
becomes increased. When hepatic cells are infected with Chlamydia species,
the decreased energy in the host cell does not allow heme biosynthesis to go
to completion and porphyrins in the liver/entero-hepatic circulation are
increased. It also has been noted that any host cell infected with Chlamydia
species has an increased amount of intracellular porphyrins that are
released when antimicrobial agents kill the microorganism.
Although a number of investigators have reported enigmatic porphyria in
patients who had no evidence of abnormal enzymes in the heme biosynthesis
pathway (Yeung Laiwah et al., Lancet, i:790-792 (1983); Mustajoki, P. and
Tenhunen, R., Europ. Journ. of Clin. Invest., 15:281-284 (1985)), the
intrinsic secondary, obligatory porphyria caused by chlamydial infection
disclosed herein has neither been described nor hypothesized in the medical
literature. This obligatory secondary porphyria clearly is of paramount
importance in dealing with chronic systemic chlamydial infections as are
seen with intravascular infections caused by Chlamydia pneumoniae.
The diagnosis of chlarnydial-associated secondary porphyria is important
because of the well known neuropsychiatiric manifestations of porphyrias
(Gibson et al., Journal of Pathology and Bacteriology, 71:495-509 (1956);
Bonkowsky et al., Seminars in Liver Diseases, 2:108-124 (1982); Brennan et
al., International Journal of Biochemistry, 833-835 (1980); Burgoyne et al.,
Psychotherapy and Psychosomatics, 64:121-131 (1995)). Moreover, chronic
exposure to excess porphyrins has been associated with cancer (Kordac V.,
Neoplasma, 19:135-139 (1972); Lithner et al., Acta Medica Scandanavia,
215:271-274 (1984)). Of particular interest is that infection with Chlamydia
pneumoniae has been associated with lung cancer (Cerutti P A., Science,
227:375-381 (1985)).
The diagnosis of genetic porphyria in patients with systemic chlamydial
infections is important as these patients may precipitate a severe porphyric
attack when they receive antimicrobial agents to treat their infection.
Thus, in order to control the severe porphyria, these patients may require
intravenous hematin and/or plasmapheresis in addition to the oral anti-porphyric
agents. In contrast, the diagnosis of chlamydial-associated secondary
porphyria may be difficult as the porphyria may be minimal and
tissue-specific. The measurement of 24 hour urine porphyrins is not
sensitive enough in every case of chlamydial infection to detect the
secondary porphyria caused by chlamydial infection.
In view of the foregoing discussion of the etiology of porphyria, one aspect
of the invention pertains to methods for differentiating porphyria caused by
Chlamydia from that caused by a latent genetic disorder in an individual.
The method comprises treating infection by Chlamydia at all stages of its
life cycle, using the therapies described in detail elsewhere in this
disclosure, and then assessing whether symptoms of porphyria have been
reduced. A reduction in the symptoms of porphyria (e.g., biochemical,
enzymatic or physical manifestation) are indicative that the porphyria is a
secondary porphyria caused by Chlamydia.
The diagnosis of genetic porphyria is most easily done during an acute
porphyric attack as there are porphyrinogen precursors and porphyrins in the
blood, urine and stool (Kauppinen et al., British Journal of Cancer,
57:117-120(1988)). The diagnosis of secondary porphyria is not as easy to do
as there may not be an abnormal amount of porphyrinogen precursors and
porphyrins in the blood, urine, or stool. However, several early enzymes in
the pathway for heme biosynthesis can be readily measured in peripheral red
blood cell (Percy et al., South African Forensic Medicine Journal,
52:219-222 (1977); Welland et al., Metabolism, 13:232-250 (1964); McColl et
al., Journal of Medical Genetics, 19:271-276 (1982)). Specific hereditary
porphyrias that can be diagnosed with the measurement of low levels of
peripheral red blood cell enzymes are acute intermittent porphyria,
congenital erythropoietic porphyria, .DELTA.-aminolevulinic acid dehydratase
deficiency porphyria, and porphyria cutanea tarda. Therefore, elevated
porphyrin levels in patients who do not have low levels of these enzymes is
suggestive of a non-genetic porphyria, such as chlamydially induced
secondary porphyria. For example, in one embodiment, porphyria caused by
Chlamydia in an individual having symptoms associated therewith can be
diagnosed by determining the presence and/or amount of obligatory enzymes in
heme biosynthesis in red blood cells of the individual. The presence or
amount of the obligatory enzyme is compared to a normal patient who does not
have porphyria or to an earlier test result in the patient to determine the
patient's porphyria symptoms and/or whether therapy is effective. For
example, the presence of ALA synthase and/or PBF deaminase or any of the
other known enzymes involved in heme biosynthesis (see Table 7), in abnormal
levels (i.e., significant deviation from normal levels in healthy patients
who do not have genetic porphyria) is indicative of secondary porphyria.
The diagnosis of chlamydial-associated secondary porphyria may be difficult
as the porphyria may be minimal and tissue-specific. The measurement of 24
hour urine or stool porphyrins may not be sensitive enough in many cases of
chlamydial infection to detect the secondary porphyria. Here, the diagnosis
depends on the fact that if excess porphyrins are reaching the circulation,
the precursor red blood cells will absorb these and make heme. Thus, the
enzymes for heme biosynthesis in the differentiated red blood cell become
elevated and remain elevated for the life of the red cell. This allows the
diagnosis of episodic low-level secondary porphyria as is seen with
chlamydial infections. Thus, elevated heme synthesis levels can be used to
diagnose intracellular porphyria. See Example 7.
As discussed above, some patients having a Chlamydia-induced porphyria do
not have abnormal levels of heme precursors. For those patients it may be
appropriate to determine the presence of Chlamydia as well as porphyrins in
the individual. The presence of both the pathogen and porphyrins (e.g.,
determined by ELISA assay described below) is indicative of secondary
chlamydial porphyria, rather than a genetic based porphyria. A proper
diagnosis can thus determine the therapeutic regimen needed to treat
infection and symptoms of secondary porphyria.
The inventors have discovered the existence of antibodies to the various
metabolites of heme biosynthesis, as well as Vitamin B12 (cobalamin), which
is molecularly similar to these metabolites, in patients with active
systemic infection with C. pneumoniae. The antibodies are primarily IgM;
this is similar to the antibody responses to the MOMP of C. pneumoniae in
severely symptomatic patients. Example 8 illustrates titers in symptomatic
patients with systemic C. pneumoniae infections. The presence of antibodies
to Vitamin B12 may have functional significance by decreasing the amount of
bioavilable Vitamin B12. Thus, a Chlamydia infection may cause a previously
unrecognized secondary Vitamin B12 deficiency. Administration (e.g.,
intramuscular) of large quantities of Vitamin B12 (1000 to 5000 .mu.g)
(e.g., parenteral cobalamin therapy) creates large amounts of Vitamin B12
available for binding to thc native receptors of antibodies with an affinity
for Vitamin B12, thereby saturating these anti-Vitamin B12 antibodies and
increasing the amount of bioavailable circulating Vitamin B12.
The previously unknown fact that the body produces antibodies to porphyrins
makes it possible to diagnose the presence of porphyrins in a patient or
animal by determining the presence of anti-porphyrin antibodies. The
inventors have developed a method in which IgM and IgG antibodies to
porphyrins can be measured with an ELISA method. This has been shown to be a
much more accurate method to determine the chronic presence of porphyrins.
Porphyrins can also be used to create monoclonal and polyclonal antibodies
using standard methods known to any one skilled in the field. These
antibodies can be used in a variety of diagnostic assays and anti-porphyrin
therapeutic strategies.
Treatment of Chlamydia infection may exaserbate secondary porphyria by
increasing the metabolism of cryptic Chlamydia or by accelerating the death
of infected cells with elevated intracellular porphyrin levels.
Once secondary porphyria is diagnosed, chlamydial infection and symptoms
associated with porphyria can be treated. lThe following therapeutic regimen
is aimed at controlling the chlamydial-associated secondary/obligatory
porphyria, symptoms of which can actually increase during antimicrobial
therapy of the chlamydial infection. This porphyric reaction to
antimicrobial therapy should be recognized as such and differentiated from
the expected cytokine-mediated immune response precipitated by antigen dump
during anti-chlamydial therapy. These obligatory and secondary chlamydial
metabolic disorders are treated by specific diets and a combination of
pharmacological agents, each directed at different aspects of the metabolic
disorders. For example, chlamydial-induced porphyria can be treated with a
specific antiporphyric diet and a combination of antiporphyric agents, each
directed at different aspects of porphyrins/porphyria. For purposes of this
invention, the term "antiporphyric agent(s)" is intended to embrace any of
the therapies described herein for management of porphyria. In addition to
the antiporphyric diet and antiporphyric agents, the patient may require
intravenous glucose and hematin, renal dialysis, and/or plasmaphoresis,
particularly for those patients having both genetic porphyria and secondary
porphyria induced by a chlamydial infection. Suitable diets and
antiporphyric agents are described in detail below.
C. Therapies to Enhance Cellular Function
Glucose is an important source of cellular energy. Glucose levels can be
enhanced by diet and through vitamin supplements as described below.
A high carbohydrate diet should be maintained to promote production of
glucose (Pierach et al., Journal of the American Medical Association,
257:60-61 (1987)). Approximately 70% of the caloric intake should be in the
form of complex carbohydrates such as bread, potato, rice and pasta. The
remaining 30% of the daily diet should comprise protein and fat, which
should ideally be in the form of fish or chicken. Red meats, including beef,
dark turkey, tuna and salmon, contain tryprophan. Increased levels of
tryptophan in the liver inhibit the activity of phosphoenol pyruvate
carboxykinase with consequent disruption of gluconeogenesis. This accounts
for the abnormal glucose tolerance seen in porphyria. Increased plasmic
concentrations of tryptophan also enhances tryptophan transport into the
brain. The concentration of tryptophan in the brain is the rate-limiting
factor for the synthesis of the neurotransmitter 5-hydroxytryptariine (5-HT,
serotonin). Serotonin is synthesized by the endothelium of brain capillaries
for circulating tryptophan. Thus, increased concentrations of tryptophan in
the brain would be expected to enhance production of serotonin and its
metabolic, 5-hydroxyindole-acetic acid (5HIAA). Acute increases in serotonin
turnover in the brain are followed by vascular and metabolic changes which
include decreases in glucose consumption, disturbances in EEG tracings, and
decreases in the postischemic neurological score. In addition, while
serotonin increases brain perfusion on a single injection, repetitive
administration initially opens the blood-brain barrier and subsequently
induces vasoconstriction. It is likely that any transient opening of the
blood-brain barrier by serotonin could allow circulating substrates such as
ALA and PBG, if present, to enter the central nervous system. As would be
expected from the location of serotonin receptors and from the barrier
function of the endothelium of cerebral arteries, the constricting effect of
serotonin is amplified in cerebral arteries where endothelium is damage or
removed. Damaged endothelial cells, as would be expected with chlamydial
infection, would no longer have operational catabolic processes for
serotonin. This would be particularly true in the event of depleted ATP as
caused by chlamydial infection. This means that increased concentrations of
serotonin will reach the smooth muscle layer of the cerebral vessels and
cause more constriction. Finally, serotonin is also stored in blood
platelets. Because blood platelets do not adhere and aggregate under normal
conditions, they do not release serotonin when the vessel lumen is intact.
However. if the vessel lumen is altered by chlamydial infection, platelet
deposition and release of serotonin can occur.
Another adverse effect of increased serotonin levels due to porphyria is
seen with nervous tissues. Sympathetic nerve endings store serotonin taken
up from the circulation. These serotonergic neurons form plexuses around
brain vessels where they are likely to liberate their serotonin contents
when subjected to cellular lysis from any cause including, ischemia,
fiee-radicaI ionizing damage to cell membranes, and/or chlamydial infection.
In rats, elevated circulating tryptophan has been shown to produce
structural alteration of brain astrocytes, oligodendroglia, and neurons, as
well as degeneration of Purkinje cells and wasting of axons. Similar
neurohistological alterations have been reported in patients with acute
porphyria. Elevated tryptophan levels in plasma and brain have been
associated with human encepholopathy. Finally, serotonin is also recognized
as an active neurotransmitter in the gastrointestinal tract. The
pharmacologic effects of serotonin in the central nervous system and
gastrointestinal tract resemble the neurological manifestations of acute
porphyric attacks. In fact, administration of either tryptophan or serotonin
to humans have been reported to cause severe abdominal pain, psychomotor
disturbances, nausea, and dysuria; all of which are symptoms of acute
porphyria.
Sucrose and fructose should be avoided (Bottomly et al., American Journal of
Clinical Pathology, 76:133-139 (198 1)) because the ingestion of large
amounts of fructose trigger hepatic gluconeogenesis which then decreases the
available glucose which is derived from glycogen breakdown within the liver.
It is recommended that sport drinks which contain glucose be consumed.
It is recommended that a patient suffering from porphyria avoid milk
products. Milk products contain lactose and lactoferrin, and have been
empirically shown to make symptoms of porphyria worse.
Multivitamins containing the B complex vitamins should be administered daily
(e.g., one or multiple times), preferably in excess of RDA, to enhance
glucose availability. Hepatic breakdown of glycogen with generation of
glucose is assisted by taking these multivitamins that contain the B complex
vitamins. Pyridoxine minimizes the porphyrin related porphyrial neuropathy.
B complex vitamins include folic acid (e.g., 400 .mu.g per dosage; 1200 .mu.g
daily maximum); vitamin B-1 (thiamin; e.g., 10 mg per dosage; 30 mg daily
maximum); B-2 (riboflavin; e.g., 10 mg per dosage; 30 mg daily maximum); B-5
(panothenate; e.g., 100 mg per dosage; 300 mg daily maximum); B-6
(pyridoxine; e.g., 100 mg per dosage; 300 mg daily maximum) or
pyridoxal-5-phosphate (e.g., 25 mg per dosage; 100 mg daily maximum) and
B-12 (e.g., 500 .mu.g per dosage; 10,000 .mu.g daily maximum). The preferred
method of administration is oral for the majority of these vitamins (twice
daily), except for B-12 for which sublingual administration (three-times
daily) is preferred. It has been discovered that one important effect of
this secondary porphyria in some patients is the production of IgM and IgG
antibodies against coproporphyrinogen-III. These antibodies cross-react with
Vitamin B12 (cobalamin) and can thus cause a deficiency. Vitamin B12
supplementation (e.g., parenteral cobalamin therapy) can remedy the
deficiency.
D. Reducing Porphyrin Levels
Dietary and pharmaceutical methods can be used to reduce systemic porphyrin
levels (both water-soluble and fat-soluble).
Plenty of oral fluids in the form of bicarbonated water or "sports drinks"
(i.e., water with glucose and salts) should be incorporated into the
regimen. This flushes water-soluble porphyrins from the patient's system.
Drinking seltzer water is the easiest way to achieve this goal. The color of
the urine should always be almost clear instead of yellow. It is noted that
dehydration concentrates prophyrins and makes patients more symptomatic.
Activated charcoal can be daily administered in an amount sufficient to
absorb fat-soluble porphyrins from the enterohepatic circulation. Treatment
with activated oral charcoal, which is nonabsorbable and binds porphyrins in
the gastrointestinal tract and hence interrupts their enterohepatic
circulation, has been associated with a decrease of plasma and skin
porphyrin lcvels. Charcoal should be taken between meals and without any
other oral drugs or.the charcoal will absorb the food or drugs rather than
the porphyrins. For those who have difficulty taking the charcoal due to
other medications being taken during the day, the charcoal can be taken all
at one time before bed. Taking between 2 and 20 grams, preferably at least 6
grams (24x250 mg capsules) of activated charcoal per day (Perlroth et
al., Metabolism, 17:571-581 (1968)) is recommended. Much more charcoal can
be safely taken; up to 20 grams six times a day for nine months has been
taken without any side effects.
For severe porphyria, chelating and other agents may be administered,
singularly or in combination, to reduce levels of porphyrins in the blood.
Examples of chelating agents include but are not limited to Kemet (succimer;
from about 10 mg/kg to about 30 mg/kg); ethylene diamine tetracetic acid (EDTA);
BAL (dimercaprol; e.g., 5 mg/kg maximum tolerated dosage every four hours),
edetate calcium disodium (e.g., from about 1000 mg/m2 to about 5000
mg/m2 per day; can be used in combination with BAL); deferoxamine
mesylate (e.g., from about 500 mg to about 6000 mg per day); trientine
hydrochloride (e.g., from about 500 mg to about 3g per day); panhematin
(e.g., from about 1 mg/kg to about 6 mg/kg per day), penacillamine.
Intravenous hematin may also be administered. Quinine derivatives, such as
but limited to hydroxychloroquine, chloroquine and quinacrine, should be
administered to the patient daily at a dosage of from about 100 mg to about
400 mg per day, preferably about 200 mg once or twice per day with a maximum
daily dose of 1 g. Hydrochloroquine is most preferred. The mechanism of
action of hydroxychloroquine is thought to involve the formation of a
water-soluble drug-porphyria complex which is removed from the liver and
excreted in the urine (Tschudy et al., Metabolism, 13:396-406 (1964);
Primstone et al., The New England Journal of Medicine, 316:390-393 (1987)).
To reduce severe porphyric attacks during therapy for chronic Chlamydia
infections, the use of hemodialysis. plasmapheresis, chelating agents and/or
intravenous hematin may be needed. Any one of these or a combination thereof
can be used to treat the patient and is well within the knowledge of the
skilled artisan how to carry out these adjunct therapies.
E. Mitigating the Effects of Porphyrins
Antioxidants at high dosages (preferably taken twice per day) help to
mitigate the effects of free radicals produced by porphyrins. Examples of
suitable antioxidants include but are not limited to Vitamin C (e.g., 1 gram
per dosage; 10 g daily maximum); Vitamin E (e.g., 400 units per dosage; 3000
daily maximum); L-Carnitine (e.g., 500 mg per dosage; 3 g daily maximum);
coenzyme Q-10 (uniquinone (e.g., 30 mg per dosage; 200 mg daily maximum);
biotin (e.g., 5 mg per dosage; 20 mg daily maximum); lipoic acid (e.g., 400
mg per dosage; 1 g daily maximum); selenium (e.g., 100 .mu.g per dosage; 300
.mu.g daily maximum); gultamine (e.g., from 2 to about 4 g per dosage);
glucosamine (e.g., from about 750 to about 1000 mg per dosage); and
chondroitin sulfate (e.g., from about 250 to about 500 mg per dosage).
The above-mentioned therapeutic diets can be combined with traditional or
currently recognized drug therapies for porphyria. In one embodiment,
benzodiazapine drugs, such as but not limited to valium, klonafin,
flurazepam hydrochloride (e.g., Dalmane.TM., Roche) and alprazolam (e.g.,
Xanax), can be administered. Preferably, sedatives, such as alprazolam
(e.g., Xanax; 0.5 mg per dosage for 3 to 4 times daily), can be prescribed
for panic attacks and flurazepam hydrochloride (e.g., Dalmane.TM., Roche or
Restoril.TM. (e.g., 30 mg per dosage)) can be prescribed for sleeping. The
rationale is based upon the presence of peripheral benzodiazepine receptors
in high quantities in phagocytic cells known to produce high levels of
radical oxygen species. A protective role against hydrogen peroxide has been
demonstrated for peripheral benzodiazipine receptors. This suggests that
these receptors may prevent mitochondria from radical damages and thereby
regulate apoptosis in the hematopoietic system. Benzodiazepines have also
been shown to interfere with the intracellular circulation of heme and
porphyrinogens (Scholnick et al., Journal of Investigative Dermatology,
1973, 61:226-232). This is likely to decrease porphyrins and their adverse
effects. The specific benzodiazipine will depend on the porphyrin-related
symptoms.
Cimetidine can also be administered separately or in combination with
benzodiazepine drugs. Cimetidine has been shown to effectively scavenge
hydroxyl radicals although it is an ineffective scavenger for superoxide
anion and hydrogen peroxide. Cimetidine appears to be able to bind and
inactivate iron, which further emphasizes its antioxidant capacity.
Cimetidine also is an effective scavenger for hypochlorous acid and
monochloramine, which are cytotoxic oxidants arising from inflammatory
cells, such as neutrophils. Cimetidine thus would be expected to be useful
for the therapy of free-radical-mediated oxidative damage caused by
chlamydial porphyria. Recent studies in Japan have found that cimetadine is
effective for treating porphyria. The recommended amount of cimetadine is
about 400 mg once or twice per day.
The complexity of the chlamydial life cycle. the host response to infection
as well as to therapy, the high frequency of untoward side effects of
antimicrobial therapy, the obligatory metabolic disorders. and the need for
prolonged therapy make patient education, monitoring and support a necessary
and key factor in the successful erradication of chronic/systemic chlamydial
infections. When the presence of chlamydial in the blood is detected by
culture and/or PCR and the IgM and IgG antibody titers are elevated, a
presumptive diagnosis of chronic/systemic chlamydial infection is made. The
potential for secondary effects such as porphyria should then be screened.
For example, this can be evaluated by performing one or a combination of the
following tests: 1) complete blood count (CBC); 2) Liver function tests; 3)
Uric acid; 4) Serum iron studies; 5) IgM and IgG antibodies to
coproporpyrinogen-III and Vitamin B12; and, 6) ALA dehydratase and PBG
deaminase. Urine and stool samples should also be tested for presence of
porphyrins, preferably using 24 hour samples. In a preferred embodiment of
the therapeutic regimen, the patient is placed on the antiporphyric regimen,
preferably for at least two weeks before any antibiotics are started.
Following this, a reducing agent is started. These include amoxicillin (500
mg every 12 hours), penicillamine (250 mg every 12 hours), and cycloserine
(250 mg every 12 hours). The patient is closely monitored for at least two
weeks on this regimen to determine if any side effects occur. This regimen
is continued for the entire course of therapy and is critical as it
decreases the EB load. After the patient has adjusted to the amoxicillin or
penicillamine, a combination of antimicrobial agents is added. The patient
is closely monitored to determine tolerance to the antimicrobial agents.
Vitamins, antioxidants and other antiporphyric agents can be incorporated,
in the amounts described herein, into nutraceuticals, medical foods, dietary
supplements and dietary nutritional formulations including beverages and
foods such as nutritional bar, for the management of non-genetic, secondary
porphyria caused by a Chlamydia infection. Alternatively, a combination of
vitamins and antioxidants can be co-packed in a pack or kit as described
elsewhere herein and/or co-formulated into a composition in amounts suitable
for administration to an individual having non-genetic, secondary prophyria.
Modes of Administration
Based upon the ability of the combination therapy of this invention to
improve both the serological and physical status of a patient undergoing
treatment, pharmaceutical compositions or preparations can be made
comprising at least two different agents chosen from the following groups:
a) at least one agent targeted against elementary body phase of chlamydial
life cycle (e.g., disulfide reducing agents); b) at least one agent targeted
against replicating phase of chlamydial life cycle (e.g., antimycobacterial
agents); and c) at least one agent targeted against cryptic phase of
chlamydial life cycle (e.g. anerobic bactericidal agents). As discussed in
greater detail below, the agents can be formulated in a physiologically
acceptable vehicle in a form which will be dependent upon the method in
which it is administered.
In another aspect, the invention pertains to a combination of agents
comprising at least two agents, each of which is targeted against a
different phase of the chlamydial life cycle, as previously discussed. The
combination of antichlamydial agents can be used in the management of
chlamydial infection or prophylaxis thereof to prevent recurrent infection.
The combination of agents can be in the form of an admixture, as a pack
(discussed in detail below) or individually, and/or by virtue of the
instruction to produce such a combination. It should be understood that
combination therapy can comprise multiple agents that are effective within a
particular phase of the chlamydial life cycle. The combination of
antichlamydial agents can further comprise immunosuppressants,
anti-inflammatory agents, vitamin C and combinations thereof.
In a preferred embodiment. if only one antichlamydial agent is elected to be
used in an asymptomatic patient to reduce/prevent chronic infection, this
agent is a reducing agent, such as penicillamine.
The novel therapeutic methods described herein can be used to ameliorate
conditions/symptoms associated with the disease states described above, when
the disease is onset or aggravated by infection by Chlamydia. The agents of
this invention can be administered to animals including, but not limited to,
fish, amphibians, reptiles, avians and mammals including humans. Compounds
and agents described herein can be administered to an individual using
standard methods and modes which are typically routine for the disease
state.
Combination(s) of antichiamydial agents of this invention can be used for
the manufacture of a medicament for simultaneous, separate or sequential use
in managing chlamydial infection or prophylaxis thereof. The agents can also
be used for the manufacture of a medicament for therapy of a disease
associated with chlamydia infection, such as autoimmune disease,
inflammatory disease, immunodeficiency disease.
The agents can be administered subcutaneously, intravenously, parenterally,
intraperitoneally, intradermally, intramuscularly, topically, enteral (e.g.,
orally), sublingually, rectally, nasally, buccally, vaginally, by inhalation
spray, by drug pump or via an implanted reservoir in dosage formulations
containing conventional non-toxic, physiologically acceptable carriers or
vehicles. The preferred method of administration is by oral delivery. The
form in which it is administered (e.g., syrup, elixir, capsule, tablet,
solution, foams, emulsion, gel, sol) will depend in part on the route by
which it is administered. For example, for mucosal (e.g., oral mucosa,
rectal, intestinal mucosa, bronchial mucosa) administration, via nose drops,
aerosols, inhalants, nebulizers, eye drops or suppositories can be used. The
compounds and agents of this invention can be administered together with
other biologically active agents.
In a specific embodiment, it may be desirable to administer the agents of
the invention locally to a localized area in need of treatment; this may be
achieved by, for example, and not by way of limitation, local infusion
during surgery, topical application (e.g., for skin conditions such as
psoriasis), transdermal patches, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant being of a
porous, non-porous, or gelatinous material, including membranes, such as
sialastic membranes or fibers. For example, the agent can be injected into
the joints.
In a specific embodiment when it is desirable to direct the drug to the
central nervous system, techniques which can opportunistically open the
blood brain barrier for a time adequate to deliver the drug there through
can be used. For example, a composition of 5% mannitose and water can be
used. In another embodiment, the agents can be delivered to a fetus through
the placenta since many of the agents are small enough to pass through the
placental barrier.
The present invention also provides pharmaceutical compositions. Such
compositions comprise a therapeutically (or prophylactically) effective
amount of the agent, and a pharmaceutically acceptable carrier or excipient.
Such a carrier includes but is not limited to saline, buffered saline,
dextrose, water, glycerol, ethanol, and combinations thereof. The carrier
and composition can be sterile. The formulation should suit the mode of
administration.
Suitable pharmaceutically acceptable carriers include but are not limited to
water, salt solutions (e.g., NaCl), alcohols, gum arabic, vegetable oils,
benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as
lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous
paraffin, perfume oil, fatty acid esters, hydroxymethylcellulose, polyvinyl
pyrolidone, etc. The pharmaceutical preparations can be sterilized and if
desired, mixed with auxiliary agents, e.g., lubricants, preservatives,
stabilizers, wetting agents, emulsifiers, salts for influencing osmotic
pressure, buffers, coloring, flavoring and/or aromatic substances and the
like which do not deleteriously react with the active compounds.
The composition, if desired, can also contain minor amounts of wetting or
emulsifying agents, or pH buffering agents. The composition can be a liquid
solution, suspension, emulsion, tablet, pill, capsule, sustained release
formulation, or powder. The composition can be formulated as a suppository,
with traditional binders and carriers such as triglycerides. Oral
formulation can include standard carriers such as pharmaceutical grades of
mannitol, lactose, starch, magnesium stearate, polyvinyl pyrollidone, sodium
saccharine, cellulose, magnesium carbonate, etc.
The composition can be formulated in accordance with the routine procedures
as a pharmaceutical composition adapted for intravenous administration to
human beings. Typically, compositions for intravenous administration are
solutions in sterile isotonic aqueous buffer. Where necessary, the
composition may also include a solubilizing agent and a local anesthetic to
ease pain at the site of the injection. Generally, the ingredients are
supplied either separately or mixed together in unit dosage form, for
example, as a dry lyophilized powder or water free concentrate in a
hermetically sealed container such as an ampoule or sachette indicating the
quantity of active agent. Where the composition is to be administered by
infusion, it can be dispensed with an infusion bottle containing sterile
pharmaceutical grade water, saline or dextrose/water. Where the composition
is administered by injection, an ampoule of sterile water for injection or
saline can be provided so that the ingredients may be mixed prior to
administration.
For topical application, there are employed as nonsprayable forms, viscous
to semi-solid or solid forms comprising a carrier compatible with topical
application and having a dynamic viscosity preferably greater than water.
Suitable formulations include but are not limited to solutions, suspensions,
emulsions, creams, ointments, powders, enemas, lotions, sols, liniments,
salves. aerosols, etc., which are, if desired, sterilized or mixed with
auxiliary agents, e.g., preservatives, stabilizers, wetting agents, buffers
or salts for influencing osmotic pressure, etc. The drug may be incorporated
into a cosmetic formulation. For topical application, also suitable are
sprayable aerosol preparations wherein the active ingredient, preferably in
combination with a solid or liquid inert carrier material, is packaged in a
squeeze bottle or in admixture with a pressurized volatile, normally gaseous
propellant, e.g., pressurized air.
Agents described herein can be formulated as neutral or salt forms.
Pharmaceutically acceptable salts include those formed with free amino
groups such as those derived from hydrochloric, phosphoric, acetic, oxalic,
tartaric acids, etc., and those formed with free carboxyl groups such as
those derived from sodium, potassium, ammoniun, calcium, ferric hydroxides.
isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine,
etc.
The amount of agents which will be effective in the treatment of a
particular disorder or condition will depend on the nature of the disorder
or condition, and can be determined by standard clinical techniques. In
addition, in vitro or in vivo assays may optionally be employed to help
identify optimal dosage ranges. The precise dose to be employed in the
formulation will also depend on the route of administration, and the
seriousness of the disease or disorder, and should be decided according to
the judgment of the practitioner and each patient's circumstances. Effective
doses may be extrapolated from dose-response curves derived from in vitro or
animal model test systems.
The invention also provides a pharmaceutical pack or kit comprising one or
more containers filled with one or more of the ingredients of the
pharmaceutical compositions and/or adjunct therapies of the invention.
Optionally associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use or sale
of pharmaceuticals or biological products, which notice reflects approval by
the agency of manufacture, use of sale for human administration. The pack or
kit can be labeled with information regarding mode of administration,
sequence of drug administration (e.g., separately, sequentially or
concurrently), or the like. The pack or kit may also include means for
reminding the patient to take the therapy. The pack or kit can be a single
unit dosage of the combination therapy or it can be a plurality of unit
dosages. In particular, the agents can be separated, mixed together in any
combination, present in a single vial or tablet. Agents assembled in a
blister pack or other dispensing means is preferred. For the purpose of this
invention, unit dosage is intended to mean a dosage that is dependent on the
individual pharmacodynamics of each agent and administered in FDA approved
dosages in standard time courses.
Diagnostic Reagents
The invention also provides a diagnostic reagent pack or kit comprising one
or more containers filled with one or more of the ingredients used in the
assays of the invention. Optionally associated with such container(s) can be
a notice in the form prescribed by a governmental agency regulating the
manufacture, use or sale of diagnostic products, which notice reflects
approval by the aggency of manufacture, use of sale for human
administration. The pack or kit can be labeled with information regarding
mode of administration, sequence of execution (e.g., separately,
sequentially or concurrently), or the like. The pack or kit can be a single
unit assay or it can be a plurality of unit assays. In particular, the
agents can be separated, mixed together in any combination, present in a
single vial or tablet. For the purpose of this invention, unit assays is
intended to mean materials sufficient to perform only a single assay.
Claim 1 of 9 Claims
We claim:
1. A combination of antichlamydial agents comprising (i) a rifamycin; (ii)
an azalide or a macrolide; and (iii) penicillamine in amounts effective for
the treatment of a chlamydial infection, said combination further comprising
an anti-inflammatory agent or an immunosuppressive agent.
____________________________________________
If you want to learn more
about this patent, please go directly to the U.S.
Patent and Trademark Office Web site to access the full
patent.
|