Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 

Title:  Diagnosis and management of infection caused by chlamydia

United States Patent:  6,579,854

Issued:  June 17, 2003

Inventors:  Mitchell; William M. (Nashville, TN); Stratton; Charles W. (Nashville, TN)

Assignee:  Vanderbilt University (Nashville, TN)

Appl. No.:  073661

Filed:  May 6, 1998

Abstract

The present invention provides a unique approach for the diagnosis and management of infections by Chlamydia species, particularly C. pneumoniae. The invention is based, in part, upon the discovery that a combination of agents directed toward the various stages of the chlamydial life cycle is effective in substantially reducing infection. Products comprising combination of antichlamydial agents, novel compositions and pharmaceutical packs are also described.

DETAILED DESCRIPTION OF THE INVENTION

This invention describes specific antichlamydial agents that are used singly or in combination to eliminate or interfere with more than one of the distinct phases of the life cycle of Chlamydia species. These chlamydial phases include the intracellular metabolizing/replicating phase; the intracellular "cryptic" phases; and the extracellular EB phase. Current concepts of susceptibility testing for chlamydiae and antimicrobial therapy for their associated infections address only one phase, the replicating phase. Unless multiple phases of the life cycle are addressed by antichlamydial therapy, the pathogen is likely to escape the desired effects of the antimicrobial agent(s) used and cause recurrent infection after reactivation from latency. For the purposes of this invention, "cryptic phase" embraces any non-replicating, intracellular form, of which there are a number of distinct stages, including but not limited to intracellular EBs, EBs transforming into RBs and vice versa, miniature RBs, non-replicating RBs and the like.

Diagnostic and therapeutic methods for the management of Chiamydia infections are described in detail below. For the purposes of this invention, "management of Chlamydia infection" is defined as a substantial reduction in the presence of all phases/forms of Chlamydia in the infected host by treating the host in such a way as to minimize the sequellae of the infection. Chlamydia infections can thus be managed by a unique approach referred to herein as "combination therapy" which is defined for the purpose of this application as the administration of multiple agents which together are targeted at least two but preferably many of the multiple phases of the chlamydial life cycle, each agent taken separately, simultaneously or sequentially over the course of therapy. When used alone, these agents are unable to eliminate or manage chlamydial infection. The diagnostic methods and combination therapies described below are generally applicable for infection caused by any Chlamydia species, including but not limited to C. pneumoniae, C. trachomatis, C. psittaci and C. pecorum. Infections in which the causative agent is C. pneumoniae are emphasized.

Antichlamydial agents, which have been identified as effective against Chlamydia by the susceptibility testing methods described herein, can be used singly to affect Chlamydia in a single stage of its life cycle or as part of a combination therapy to manage Chlamydia infection. For example, compounds identified as anti-cryptic phase drugs, anti-EB phase drugs, anti-DNA-dependent RNA polymerase drugs and nicotinic acid cogener drugs can be used alone or in combination to eliminate, reduce or prevent one or more of the distinct phases of the chlamydial life cycle. Certain of these compounds have not heretofore been shown to have antichlamydial activity.

Diagnosis of Chlamydia Infection

The invention pertains to methods for diagnosing the presence of Chlamydia in a biological material, as well as to the use of these methods to evaluate the serological status of an individual undergoing antichlamydial combination therapy. For purposes of this application, "biological material" includes, but is not limited to, bodily secretions, bodily fluids and tissue specimens. Examples of bodily secretions include cervical secretions, trachial-bronchial secretions and pharyngeal secretions. Suitable bodily fluids include blood, sweat, tears, cerebral spinal system fluid, serum, sputum, ear wax, urine, snyovial fluid and saliva. Animals, cells and tissue specimens such as from a variety of biopsies are embraced by this term.

In one embodiment, peptide-based assays are disclosed for the detection of one or more immunoglobulins, such as IgG, IgM, IgA and IgE, against antigenic determinants within the full length recombinant MOMPs of various Chlamydia species. Detection of IgG and/or IgM against antigenic determinants within the full length recombinant MOMP of C. pneumoniae is preferred. IgA determinations are useful in the analysis of humoral responses to Chlamydia in secretions from mucosal surfaces (e.g., lung, GI tract, gerontourinary tract. etc.). Similarly, IgE determinations are useful in the analysis of allergic manifestatins of disease. Table 1 below provides the GenBank Accession numbers of various MOMPs for Chlamydia species.
 

    TABLE 1
                                                 GenBank
    Species             Strain       ID          Accession No.
    C. trachomatis         A          CTL/A       M33636
    C. trachomatis         A          CTL/A       M58938
                                                 M33535
    C. trachomatis         A          CTL/A       J03813
    C. trachomatis         B          CTL/B       M33636
    C. trachomatis         C          CTL/L       M17343
                                                 M19128
    C. trachomatis         D          CTL/D       A27838
    C. trachomatis         E          CTL/E       X52557
    C. trachomatis         F          CTL/F       X52080
                                                 M30501
    C. trachomatis         H          CTL/H       X16007
    C. trachomatis         L1         CTL/L1      M36533
    C. trachomatis         L2         CTL/L2      M14738
                                                 M19126
    C. trachomatis         L3         CTL/L3      X55700
    C. trachomatis    Mouse Pneumo    CTL/MP      X60678
    C. pecorum          Ovine        CPC/OP      Z18756
                    Polyarthritis
    C. psittaci       Strain 6BC     CPS/6B      X56980
    C. psittaci         Feline       CPS/F       X61096
    C. trachomatis         Da         CTL/DA      X62921
                                                 S45921
    C. pneumoniae        TWAR        CPN/HU1     M64064
                                                 M34922
                                                 M64063
    C. pneumoniae       Horse        CPN/EQ2     L04982
    (? C. pecorum)
    C. pneumoniae        TWAR        CPN/MS      not assigned
    C. psittaci         Horse        CPS/EQ1     L04982

For example, a biological material, such as a sample of tissue and/or fluid, can be obtained from an individual and a suitable assay can be used to assess the presence or amount of chlamydial nucleic acids or proteins encoded thereby. Suitable assays include immunological methods such as enzyme-linked immunosorbent assays (ELISA), including luminescence assays (e.g., fluorescence and chemiluminescence), radioimmunoassay, and immunohistology. Generally, a sample and antibody are combined under conditions suitable for the formation of an antibody-protein complex and the formation of antibody-protein complex is assessed (directly or indirectly). In all of the diagnostic methods described herein, the antibodies can be directly labeled with an enzyme, fluorophore, radioisotope or luminescer. Alternatively, antibodies can be covalently linked with a specific scavenger such as biotin. Subsequent detection is by binding avidin or strepavidin labeled with an indicator enzyme, flurophore, radioisotope, or luminescer. In this regard, the step of detection would be by enzyme reaction, fluorescence, radioactivity or luminescence emission, respectively.

The antibody can be a polyclonal or monoclonal antibody, such as anti-human monoclonal IgG or anti-human monoclonal IgM. Examples of useful antibodies include mouse anti-human monoclonal IgG that is not cross reactive to other immunoglobulins (Pharmagen; Clone G18-145, Catalog No. 34162D); mouse anti-human monoclonal IgM with no cross reactivity to other immunoglobulins (Pharmagen; Clone G20-127, Catalog No. 34152D). Peptide-based immunoassays can be developed which are Chlamydia specific or provide species specificity, but not necessarily strain specificity within a species, using monoclonal or polyclonal antibodies that are not cross-reactive to antigenic determinants on MOMP of a chlamydial species not of interest.

Recombinant-based immunological assays have been developed to quantitate the presence of immunoglobulins against the Chlamydia species. Full length recombinant Chlamydia MOMP can be synthesized using an appropriate expression system, such as in E. coli or Baculovirus. The expressed protein thus serves as the antigen for suitable immunological methods, as discussed above. Protein-based immunological techniques can be designed that are species- and strain-specific for various Chlamydia.

Diagnosis of chlamydial infection can now be made with an improved IgM/IgG C. pneumoniae method of quantitation using ELISA techniques, Western blot confirmation of ELISA specificity and the detection of the MOMP gene of C. pneumoniae in serum using specific amplification primers that allow isolation of the entire gene for analysis of expected strain-specific differences.

Any known techniques for nucleic acid (e.g., DNA and RNA) amplification can be used with the assays described herein. Preferred amplification techniques are the polymerase chain reaction (PCR) methodologies which comprise solution PCR and in situ PCR, to detect the presence or absence of unique genes of Chlamydia. Species-specific assays for detecting Chlarnydia can be designed based upon the primers selected. Examples of suitable PCR amplification primers are illustrated below in Table 2. Examples of preferred primers are illustrated in Table 3.

                                                      TABLE 2
                        Initial and Terminal Nucleotide Sequences of Chlamydial
     MOMP Genes
                                         in which entire sequence is known
                               SEQ ID
    GenBank Accession No.  ID          Initial Fifty Nucleotides
                                 NO.
    M64064/M34922/M64063   CPNHU1
     ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC                    1
    None                   CPNHU2a
     ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC                    2
    L04982                 CPNEQ1
     ATGAAAAAACTCTTGAAGTCGGCATTATTGTTTGCCGCTACGGGTTCCGC                    3
    L04982                 CPNEQ2
     ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC                    4
    X56980                 CPS/6B
     ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC                    5
    M36703                 CPS/AB1
     ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC                    6
    L39020                 CPS/AB2
     ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC                    7
    L25436                 CPS/AV/C
     ATGAAAAAACTCTTGAAATCGGCATTATTATTTGCCGCTACGGGTTCCGC                    8
    X61096                 CPS/F
     ATGAAAAAACTCTTAAAATCGGCATTATTATTTGCCGCTGCGGGTTCCGC                    9
    M33636/N58938/J03813   CTL/A
     ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC                   10
    M17343/M19128          CTL/C
     ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC                   11
    X62921/S45921          CTL/DA
     ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC                   12
    X52557                 CTL/E
     ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC                   13
    X52080/M30501          CTL/F
     ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC                   14
    X16007                 CTL/H
     ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC                   15
    M36533                 CTL/L1
     ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC                   16
    M14738/M19126          CTL/L2
     ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC                   17
    X55700                 CTL/L3
     ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC                   18
    X60678                 CTL/MP
     ATGAAAAAACTCTTGAAATCGGTATTAGCATTTGCCGTTTTGGGTTCTGC                   19
          Chlamydial
                               SEQ ID
    Species         Strain  ID          Terminal Fifty Nucleotides
                                  NO.
    C. pneumoniae   TWAR    CPNHU1
     GTTTAATTAACGAGAGAGCTGCTCACGTATCTGGTCAGTTCAGATTCTAA                   20
    C. pneumoniae   MS      CPNHU2
     GTTTAATTAACGAGAGAGCTGCTCACGTATCTGGTCAGTTCAGATTCTAA                   21
    C. psittaci     Horse   CPNEQ1
     CAACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTA                   22
    C. pneumoniae   Horse   CPNEQ2
     GTTTAATTAACGAGAGAGCTGCTCACATATCTGGTCAGTTCAGATTCTAA                   23
    C. psittaci     SBE     CPS/6B
     AACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTAA                   24
    C. psittaci     Ewe     CPS/AB1
     AACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTAA                   25
                    abortion
    C. psittaci     Bovine  CPS/AB2
     GCTTAATCAATGAAAGAGCCGCTCACATGAATGCTCAATTCAGATTCTAA                   26
                    abortion
    C. psittaci     Avian   CPS/AV/C
     GCTTAATCAATGAAAGAGCTGCTCACATGAATGCTCAATTCAGATTCTAA                   27
    C. psittaci     Feline  CPS/F
     GCTTAATCGACGAAAGAGCTGCTCACATTAATGCTCAATTCAGATTCTAA                   28
    C. trachomatis  Hu/A    CTL/A
     CGCAGTTACAGTTGAGACTCGCTTGATCGATGAGAGAGCAGCTCACGTAA                   29
    C. trachomatis  Hu/C    CTL/C
     GCTTGATCGATGAGAGAGCAGGTCACGTAAATGCACAATTCCGGTTCTAA                   30
    C. trachomatis  Hu/Da   CTL/DA
     GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA                   31
    C. trachomatis  HU/E    CTL/E
     CGCTTGATCGATGAGAGACTGCTCACGTAAATGCACAATTCCGCTTCTAA                   32
    C. trachomatis  Hu/F    CTL/F
     GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA                   33
    C. trachomatis  Hu/H    CTL/H
     GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA                   34
    C. trachomatis  Hu/L1   CTL/Li
     GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA                   35
    C. trachomatis  Hu/L2   CTL/L2
     GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA                   36
    C. trachomatis  Hu/L3   CTL/L3
     GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA                   37
    C. trachomatis  Mouse   CTL/MP
     GCTTGATCGATGAAAGAGCAGCTCACGTAAATGCTCAGTTCCGTTTCTAA                   38
    a Sequence from a cerebral spinal fluid of a patient with multiple
     sclerosis isolated by the inventors. Sequence is identical to TWAR C.
     pneumoniae with exception of a C/T mutation at NT 54 and a G/A mutation at
     NT 126.
    b Terminator condon underlined


TABLE 3 Primers for PCR Amplification of Entire MOMP Genea Chlamydia SEQ ID Species Strain ID Sequence Tmb NO. Plus Strand Primer C. pneumoniae TWAR CHLMOMP ATGAAAAAAC TCTTAAAGTC GGCGTTATTA 61.4o 105 DB2 TCCGCCGC C. trachomatis L2 CTMOMP ATGAAAAAAC TCTTGAAATC GGTATTAGTG 61.2o 106 L2DB TTTGCCGCTT TGAG C. psittaci Feline PSOMP ATGAAAAAAC TCTTAAAATC GGCATTATTA 62.1o 107 FPN-D TTTGCCGCTG CGGG C. psittaci 6BC PSOMP ATGAAAAAAC TCTTGAAATC GGCATTATTG 63.0o 108 6BC-b TTTGCCGCTA CGGG C. trachomatis Mouse CTMU ATGAAAAAAC TCTTGAAATC GGTATTAGCA 63.5o 109 MOMP-D TTTGCCGTTT TGGGTTCTGC Minus Strand Primer C. pneumoniae TWAR CHLMOMP TTAGAATCTG AACTGACCAG ATACGTGAGC 64.4o 110 CB2 AGCTCTCTCG C. trachomatis L2 CTMOMP TTAGAAGCGG AATTGTGCAT TTACGTGAGC 61.5o 111 L2CB AGCTC C. psittaci Feline PSOMP TTAGAATCTG AATTGAGCAT TAATGTGAGC 62.2o 112 FPN_C AGCTCTTTCG TCG C. psittaci 6BC PSOMP TTAGAATCTG AATTGACCAT TCATGTGAGC 63.4o 113 GBC_C AGCTCTTTCA TTGATTAAGC G C. trachomatis Mouse CTMU TTAGAAACGG AACTGAGCAT TTACGTGAGC 63.2o 114 MOMP_C TGCTCTTTCA TC a All primers amplify under identical amplification conditions: 94o C. for 1 min., 58o C. for 2 min., 74o C. for 3 min., for 35 cycles with 72o C. for 10 min. extension of last cycle. b Melting temperature in degrees Celsius of a nucleic acid isomer based on the equation of Mermur and Doty (J. Mol. Biol. 5: 109-118, 1962) where Tm = 81.5 + 16.6 log10 (Na+ /K+) + 41 (GC) - 600/L where (Na+ /K+) in the molar cation concentration, GC in the mole fraction of GC and L is the sequence fragment length. (Na+ /K+) used for computation was 0.05M.

Ligase chain reaction can also be carried out by the methods of this invention; primers/probes therefor can be constructed using ordinary skill. Amplification of the entire MOMP gene is useful for mutational analysis and the production of recombinant MOMP. Shorter primers can be used for specific amplification of most of the MOMP genome with a modification of amplification protocol. For example, a 22 bp negative strand primer of the sequence 5'-CAGATACGTG AGCAGCTCTC TC-3'(CPNMOMPC; SEQ ID NO. 39) with a computed Tm =55o plus a 25 bp positive strand primer of the sequence 5'-CTCTTAAAGT CGGCGTTATT ATCCG-3'(CPNMOMPD; SEQ ID NO. 40) with a computed Tm =53.9o can be used as a primer pair by adjusting the hybridization step in the amplification protocol (Table 2) from 58o C. to 50o C. Similarly, smaller regions of MOMP can be amplified by a large variety of primer pairs for diagnostic purposes although the utility of strain identification is reduced and amplification may be blocked if one or both primer pairs hybridize to a region that has been mutated. Extensive experience with the full length MOMP PCR amplification indicates that mutational events within the CHLMOMPDB2 and CHLMOMPCB2 hybridization sites are rare or non-existent.

The nucleic acid amplification techniques described above can be used to evaluate the course of antichlamydial therapy. The continued absence of detectable chlamydial DNA encoding MOMP as a function of antichlamydial therapy is indicative of clinical management of the chlamydial infection. Serological improvement can be based upon the current serological criteria for eradication of chronic Chlamydia reported below in Table 4.

 

                             TABLE 4
               Serological Criteria for Eradication
            of Chronic Chlamydia pneumoniae Infection
                IgM                .ltoreq.1:25
                IgG                Stable titer 1:100
                PCR                Negative

Preferred PCR techniques are discussed in detail below in the Example Section. In general, solution PCR is carried out on a biological material by first pre-incubating the material in an appropriate reducing agent that is capable of reducing the disulfide bonds which maintain the integrity of the MOMP and other surface proteins of the chlamydial elementary bodies, thereby compromising the outer protective shell of the EBs and allowing protease penetration. Suitable disulfide reducing agents include, but are not limited to, dithiothreitol, succimer, glutathione, DL-penicillamine, D-penicillamine disulfide, 2,2'-dimercaptoadipic acid, 2,3-dimercapto-1-propone-sulfide acid. Appropriate concentrations ofthese reducing agents can be readily determined by the skilled artisan without undue experimentation using a 10 .mu.M concentration of dithiothreitol (the preferred reducing agent) as a guideline. Failure to include a reducing agent in the initial step may prevent DNA of EBs from being isolated in the subsequent step. Data presented in Example 1 shows the effects of various reducing agents on the susceptibility of EBs to proteinase K digestion. The in vitro data shows that dithiothreitol is most effective at opening EBs for protease digestion.

Once the outer shell of the EBs has been released, the pre-incubated material is subjected to protein digestion using a protease (e.g., proteinase K), or functionally equivalent enzyme. The DNA is extracted and subjected to a nucleic acid amplification technique, e.g., PCR. The entire gene or portion thereof containing unique antigenic determinant(s) encoding MOMP or other suitable gene can then be amplified using appropriate primers flanking the gene to be amplified. For example, the gene or portion thereof can be the gene encoding MOMP, OMP-B, GRO-ES, GRO-EL, DNAK, 16S RNA, 23S RNA, the gene encoding ribonuclease-P, a 76 kd attachment protein or a KDO-transferasc gene. In an alternative method, guanidine thiocyanate, at preferably a concentration of 4M, or functionally equivalent reducing denaturant may be substituted for the disulfide reduction/protease steps.

The amplified DNA is then separated and identified by standard electrophoretic techniques. DNA bands are identified using ethidium bromide staining and UV light detection. PCR primers can be designed to selectively amplify DNA encoding MOMP of a particular Chlamydia species, such as the MOMP of C. pneumoniae, C. pecorum, C. trachomatis, C. psittaci (See FIG. 1). Primers that are from about 15-mer to about 40-mer can be designed for this purpose.

For in situ PCR, the amplification primers are designed with a reporter molecule conjugated to the 5'-terminus. Suitable reporter molecules are well known and can be used herein. However, biotin-labeled primers are preferred. For the MOMP gene, the primers CHLMOMPDB2 and CHLMOMPCB2 have been engineered with a biotin at the 5'-terminus. For in situ PCR, using biotin labels incorporated at the 5'-terminus of the amplification primers, each DNA chain amplification results in each double strand DNA containing 2 molecules of biotin. Alternatively, other specific DNA sequences can be used, although the above-described sequence is the preferred embodiment since the large product produced (1.2 kb) prevents diffusion that may be encountered with smaller DNA amplifications. Similarly, other detection labels can be incorporated (i.e., fluorescein, for example) at the 5'-end or digoxigenin-dUTP (replacement for dTPP) can be incorporated within the amplified DNA. Alternatively to labeling the product, specific hybridization probes to constant regions of the amplified DNA can be used to identify an amplified product. This latter method has particular utility for the construction of automated laboratory equipment for solution-based PCR. For example, strepavidin-coated ELISA plates can be used to capture one or both strands of a biotin 5'-labeled DNA with detection by fluorescence of a fluorescein or other incorporated fluorophore detection probe.

Clearing and Maintaining Chlamydia-free Organisms

The present invention provides a unique approach for creating and maintaining animals and cell lines which are free of Chlamydia infection. Also described herein are methods for creating nutrients and culture media that are suitable for use with animals and cell lines that have been cleared of Chlamydia infection.

Attempts to culture isolates of C. pneumoniae from blood and cerebrospinal fluid (CSF) have resulted in the discovery that the continuous cell lines routinely used to cultivate C. pneumoniae are cryptically infected with C. pneumoniae. These include not only in house stocks of HeLa, HL, H-292, HuEVEC and McCoy cells, but also stocks obtained from the American Type Culture Collection (ATCC), The University of Washington Research Foundation for HL cells, as well as a commercial supplier (Bartells) of H-292 and McCoy cells for the clinical culture of Chlamydia. The presence of a cryptic form of C. pneumoniae in these cells has been repeatedly demonstrated by solution PCR amplifying the MOMP. In situ PCR in HeLa cells against the MOMP demonstrates the MOMP genes to be present in 100% of cells. Nevertheless, fluoroscenated mAb to LPS in McCoy cells does not yield any indication of Chlamydia (i.e., reactive against all Chiamydia) while fluoroscenated mAb to C. pneumoniae MOMP yields a generalized fluorescence throughout the cytoplasm that can be confused with non-specific autofluorescence. Infection with Chlamydia trachomatis (Bartells supply) yields the typical inclusion body staining with the LPS mab (i.e., cross reactive with all species of Chlamydia) with no change in cytoplasmic signal with anti-MOMP mAb against C. pneumoniae. These findings (solution PCR, in situ PCR, mAb reactivity) were interpreted as consistent with a cryptic (non-replicating) infection by C. pneumoniae of cells commonly used to culture the organism. Further, virtually all untreated rabbits and mice tested to date have PCR signals for the C. pneumoniae MOMP gene.

This creates a currently unrecognized problem of major significance for those clinical labs providing C. pneumoniae culture services as well as investigators who now do not know whether their results in animals or in cell culture will be affected by cryptic chlamydial contamination. Clinical and research laboratories currently have no way to determine whether an organism is, in fact, Chlamydia-free.

This invention pertains to a method for clearing cells and animals of C. pneumoniae and keeping them clear. Clearing them entails contacting the infected organism with agents used singly or in combination to eliminate or interfere with more than one of the distinct phases of the life cycle of Chlamydia species. Keeping them clear entails either maintaining them on antibiotics and/or treating their nutrients and environment to ensure they are Chlamydia-free. In a preferred embodiment, maintenance conditions comprise a combination of isoniazid (INH) (1 .mu.g/ml), metronidazole (1 .mu.g/ml), and dithiothreitol (10 .mu.M) in the culture medium. Media changes are accomplished every 3 days or twice per week. The cells can be removed from the protective solution between 1 and 7 days before they are to be used for culture or other purpose.

These techniques have now made it possible to create a variety of Chlamydia-free (CF) organisms, including continuous cell lines called HeLa-CF, HL-CF, H-292-CF, HuEVEC-CF, McCoy-CF, African green monkey and other cell lines that are capable of supporting chlamydial growth. Various CF strains of mice, rabbits and other animal models for research use can be produced.

Because Chlamydia is highly infectious, organisms which have been cleared of extracellular, replicating and cryptic infections must be protected from exposure to viable EBs if the organisms are to remain clear. The inventors have discovered that many of the nutrients and other materials used to maintain continuous cell lines are contaminated with viable Chlamydia EBs. For example, every lot of fetal calf serum has tested positive for the Chlamydia MOMP gene by PCR. Since extensive digestion is required for isolation of the DNA, we have concluded it is bound in EBs. C. pneumoniae can also be cultured directly from fetal calf serum. Thus, it is necessary to inactivate EBs in these materials, such as culture media and nutrients, used to maintain the Chlamydia-free status of the organism. Collectively these materials are referred to herein as "maintenance materials"). In one embodiment, nutrients and culture media are subjected to gamma irradiation to inactivate Chlamydia therein. Preferably, the material should be irradiated for a period of time sufficient to expose the material to at least 10,000 rads of gamma radiation. It is important for the material to be contained in vessels that do not absorb high energy radiation. The preferred vessel is plastic. In another embodiment, the maintenance materials are treated with a disulfide reducing agent (e.g.,dithiothreitol (10 .mu.M) for about 30 minutes) and then the treated maintenance materials are passed through a standard submicron (e.g., about 0.45 microns) filtration system. The reducing agent causes any EBs to expand to the size where a 0.45 micron filter will block their passage. Examples of suitable disulfide reducing agents include, but are not limited to, dithiothreitol, succimer, glutathione, DL-penicillamine, D-penicillamine disulfide, 2,2'-dimercaptoadipic acid, 2,3-dimercapto-1-propone-sulfide acid. In yet another embodiment, maintenance materials are treated with a disulfide reducing agent, preferably dithiothreitol (e.g., about 10 .mu.M concentration), before the materials are passed through a filtration system to remove Chlamydia therefrom.

In order to insure that research tools, such as cell lines and animals, remain Chlamydia-free, an assay has been designed to evaluate whether an organism is Chlamydia-free. The method comprises obtaining a sample of cells or tissue culture; optionally culturing the cells in the presence or absence of cycloheximide; and determining the presence or absence of Chlamydia nucleic acid by a suitable amplification technique, such as PCR. The absence of nucleic acid amplification signal is indicative that the status of the organism is Chiamydia-free.

Susceptability Testing for Evaluating Active Agents Against Various Forms of Chlamydia

This invention pertains to novel approaches for the susceptibility testing of Chlamydia species that are necessitated by the complex life cycle of the chlamydial pathogen as well as by its diverse, extensive, and heretofore unappreciated ability to cause chronic, cryptic and persistent systemic infections that are refractory to short duration therapy with conventional single agents. The inventors have discovered that successful management or eradication of chronic/systemic chlamydial infections can be predicted by using the described unique methods for in vitro and in vivo susceptibility testing.

The invention is based upon the discovery that current susceptibility testing methods for Chlamydiae do not accurately predict the ability of antimicrobial agents to successfully and totally eradicate chronic chlamydial infections. This is because the current susceptibility testing methods measure only replication of chlamydia and ignores the well-known "cryptic phase" in which intracellular Chlamydiae are not actively replicating. Moreover, it has also been discovered that the so-called "cryptic phase" of Chlamydiae includes multiple and different sub-phases. The following are some of the phases of the chlamydial life cycle in which the intracellular Chlamydiae are not replicating: an initial intranuclear phase in which elementary bodies (EBs) transition to reticulate bodies (RBs), an intracytoplasmic phase in which there is a transition of the RB phenotype to the EB phenotype, an intracytoplasmic phase with a nonreplicating, but metabolizing RB, and intracellular/extracellular EB phases, including endocytotic and exocytotic phases, in which there is neither replication nor metabolism. In order to assess the cumulative and long term effect of antimicrobial therapy on these multiple life phases, unique in vitro and in vivo susceptibility test methods have been developed and are described herein.

The term "susceptibility" as used herein is intended to mean a physiological response of an organism to an environmental or chemical stimuli. The desired physiological response to stimuli is one which adversely affects the pathogen's viability to replicate or reside within the host cell and, ideally, would result in the reduction or complete elimination (i.e., death) of that pathogen.

A. In Vitro Methodology

One aspect of the invention pertains to methods for evaluating the susceptibility of the distinct phases and stages of the life cycle of Chlamydia, particularly the cryptic phase to a particular agent(s), since prior techniques have failed, heretofore, to appreciate the need for drugs that can clear infected cells of cryptic Chlamydia. A preferred drug screening method which accomplished this objective utilizes tissue culture cells which are maintained, in the absence of cycloheximide in order to encourage cryptic infection. Cryptic infection is uncommon in cells used in standard cell culture susceptibility techniques because Chlamydia in cycloheximide-paralyzed cells need not compete with the host cell for metabolites and hence are encouraged to replicate.

The in vitro method uses standard tissue culture cells, but without the addition of cycloheximide. Moreover, the chlamydiae are allowed to replicate for several days prior to the addition of one or more test agents. A "test agent" can be any compound or combination of compounds to be evaluated as an antichlamydial agent for its ability to significantly reduce the presence of Chlamydia in living cells. For example, a test agent can include, but is not limited to, antibiotics, antimicrobial agents, antiparasitic agents, antimalarial agent, disulfide reducing agents and antimycobacterial agents. Antimicrobial agent(s) (test agent) is then added to the replicating cells. The antimicrobial agents/growth medium are periodically replaced for the duration of the incubation time, which is preferably weeks rather than days. The test agent(s) is/are replaced when needed for the duration of the incubation time (days to weeks) to ensure that the test agent is present and has not been otherwise degraded. Finally, the end point after the prolonged incubation time is the complete absence of chlamydial DNA, as determined by a nucleic acid amplification technique, such as the polymerase chain reaction (PCR) methodology. Standard nucleic acid amplification techniques (such as PCR) are used to ascertain the presence or absence of signal for chlamydial DNA encoding MOMP or another unique Chlamydia gene to determine whether the test agent or combination of agents is/are effective in reducing Chlamydia infection. The loss of signal (i.e., below the detectable level of the nucleic acid amplification technique) in cells with antibiotic(s) versus its presence in controls is an indication of efficacy of the agent or combination of agents against Chlamydia.

Accordingly, the susceptibility test of this invention can be used to identify an agent or agents which are targeted against any particular species of Chlamydia and can be used to identify agent(s) targeted against the cryptic form of the pathogen, i.e., is capable of inhibiting or eliminating the cryptic form of the pathogen. In one embodiment, this is done by performing the susceptibility test while placing the cells under stringent environmental conditions known to induce Chlamydia to enter a cryptic phase. Agents that are effective against Chlamydia, as ascertained by the susceptibility testing protocols described herein, can be used as part of a therapy for the management of Chlamydia infections. Suitable therapeutic protocols are described in detail below, with a particular focus on targeting agents toward specific stages of the chlamydial life cycle.

The methods described herein are unique because they evaluate the activity of antimicrobial agents in the absence of cycloheximide which provides a more clinically relevant intracellular milieu. For example, any normally operating, energy-dependent host cell membrane pumps which might move antimicrobial agents in or out of the cell are inactivated by the use of cycloheximide. The methods described herein are unique because they utilize culture medium which has previously been inactivated. The methods are also unique because they measure the effect of a prolonged duration of exposure to the antimicrobial agent(s) after the intracellular infection by chlamydiae has become established. Finally, the method is unique because it measures the presence/absence of chlamydial DNA as the endpoint, for example by measuring PCR signal. By using complete eradication of chlamydial DNA as an endpoint, the susceptibility test confirms that all phases of Chlamydiae have been eradicated as opposed to there having been merely a temporary halt in replication.

When a nucleic acid amplification methodology, such as PCR, is used to evaluate assay endpoint, the nucleic acid assay (e.g., PCR) method can be enhanced by the unique application of a reducing agent, such as dithiothreitol (DTT), in order to perturb the coat of chlamydial EBs and hence allow exposure of the DNA by the action of a protein digestive compound, such as proteinase K. In other words, the reducing agent permits the EB coating to rupture. By using an assay for DNA in which EBs are specifically uncoated, the susceptibility test endpoint assesses the presence or absence of EBs as well as the presence or absence of both replicating and nonreplicating RBs. Thus, this approach for chlamydial susceptibility testing allows quantitative antimicrobial susceptibility assays of single and combination agents in which the cumulative effect of the agent(s) on the complete eradication of all life phases is measured. Examples of results obtained with this in vitro method are described below.

In one embodiment, a suitable nucleic acid assay for identifying agents effective against the cryptic form of Chlamydia comprises, in the presence of agent(s) to be tested, subjecting cultured cells to reducing agent (e.g., dithiotreitol) and protease digestion or guanidine isothiocyanate (also known as guanidine thiocyanate) for a prescribed period of time; extracting DNA from the treated solution; exposing DNA to appropriate polymerase, dNTPs and primers for DNA amplification of MOMP or other protein of the Chlamydia species; and determining the presence or absence of amplified DNA by visualizing the ethidium bromide treated DNA product by gel electrophoresis, for example, or alternatively by Southern Blot. In particular embodiments, the Chlamydia species is C. pneumoniae and the appropriate primers are CHLMOMPDB2 and CHLMOMPCB2.

The invention further relates to a method of identifying cells containing a non-EB cryptic form of a Chlamydia species by a nucleic acid amplification technique (e.g., PCR) comprising subjecting cultured cells to protease digestion; stopping protease activity; exposing cells to appropriate heat-stable DNA polymerase, dNTPs and labeled primers (e.g., 3'-biotin labeled, 5'-biotin labeled) for amplification of DNA encoding MOMP of the Chlamydia species; washing the cells; exposing the cells to a reporter molecule (e.g., strepavidin-conjugated signal enzyme); exposing the cells to an appropriate substrate for the reporter molecule (e.g., conjugated enzyme); and visualizing the amplified DNA encoding MOMP by visualizing the product of the reaction.

The invention pertains to a method of identifying cells containing a cryptic form of Chlamydia. The method comprises treating cultured cells, thought to be infected with Chlamydia, with a disulfide reducing agent; subjecting cultured cells to protease digestion; exposing cells to appropriate polymerase, dNTPs and primers for DNA amplification of nucleic acid encoding of a chlamydial protein; exposing the cells to a reporter molecule enzyme; exposing the cells to an appropriate substrate for the reporter enzyme; and determining the presence of a cryptic form of Chlamydia by visualizing the amplified DNA encoding a chlamydial protein. Preferably, the amplification technique is PCR and the primers are CHLMOMPDB2 and CHLMOMPCB2 of Chlamydia pneumoniae.

A similar method can be used as an assay for identifying an agent which is effective against a cryptic form of Chlamydia. Accordingly, the method comprises treating cultured cells grown in the absence of cycloheximide, thought to be infected with Chlamydia, with a disulfide reducing agent; allowing the Chlamydia to replicate; adding a test agent; subjecting cultured cells to protease digestion; exposing cells to appropriate polymerase, dNTPs and primers for DNA amplification of a gene encoding chlamydial protein; exposing the cells to a reporter molecule enzyme; exposing the cells to an appropriate substrate for the reporter enzyme; and determining the presence of cryptic form of Chlamydia by visualizing the amplified DNA encoding a chlamydial protein, such as MOMP.

B. In Vivo Methodology

In another aspect of the invention. the susceptibility test can be used to evaluate the status of a human or animal undergoing therapy for the management of Chlamydia infection. For example, a biological material is isolated from the human or animal to undergo combination therapy. The biological material is treated such that the Chlamydia is isolated therefrom. This chlamydial isolate is allowed to infect Chlamydia free cells. These infected cells are then exposed to the combination of agents being used in the individual undergoing combination therapy. Alternatively, the individual's serum containing the antimicrobial agents can be added to the infected cells as a "serum bactericidal test" for intracellular chlamydial infection. The presence of chlamydial DNA is then measured.

The in vivo method uses the murine model although other animals such as rats or rabbits can be used. In this method, mice (or any other animal) are inoculated intranasally with 2x105 chlamydial EBs per ml. The inventors have confirmed the work of Yang and colleagues (J. Infect. Dis., 171:736-738 (1995)) in which intranasal inoculation of chlamydial EBs results in systemic dissemination and, in particular, causes infection of the spleen. The inventors have discovered that this systemic dissemination also results in the presence of EBs in the blood of the mice. Therefore, infectivity can be measured by blood culture or by serum/whole blood PCR for chlamydial DNA. Systemic infection is also confirmed and monitored by the presence of elevated IgM and IgG antibody titers. After the systemic murine infection has been established, antimicrobial agents are given to the mice. This is most easily done by adding the antibiotics to the drinking water. The effect of antichlamydial therapy is monitored by serum/whole blood PCR. When the serum/PCR assay suggests eradication of chlamydiae from the bloodstream, the mice are sacrificed and PCR for chlamydial DNA is done on lung, heart, liver, and spleen homogenates. This method is unique because it measures the complete eradication of all life forms of chlamydiae in known murine target organs for chlamydial infection. This in vivo susceptibility method has revealed, for example, that antimicrobial therapy with the triple agents, INH, metronidazole and penicillamine, can completely eradicate C. pneumoniae from infected mice in four months. Moreover, following complete eradication of chlamydiae, multiple attempts to reinfect these cured mice via intranasal inoculation have proven unsuccessful. This suggests that effective management and complete eradiaction results in the development of protective immunity, and that effective management is therefore a way to create effective immunity.

Performing PCR for chlamydial DNA on homogenates of other organ systems can be used to determine the effectiveness of particular antibiotic combinations in eradicating chlamydial infection in those organ systems. Establishment of prior chiamydial infection of those systems can be done by either biopsy or antibody-enhanced radiological imaging. Alternatively, prior infection can be determined statistically by performing PCR for chlamydial DNA on homogenates of the same organ systems in a similarly inoculated but untreated control population. Organ-specific susceptibility is determined by comparing rates of positive PCR assays in the control and treated populations.

An alternative or complementary method of determining the presence of cryptic chlamydial infections in an animal or cell culture is to expose the culture to chlamydia-stimulating compounds. Such compounds include (but are not limited to) cycloheximide, corticosteriods (such as prednisone) and other compounds which are known to stimulate reactivation of cryptic intracellular infections, and disulfide reducing agents (such as dithiotreitol) and other chemicals which cause EBs to turn into RBs. Once the cryptic forms have entered a more active phase, they can be detected using standard detection techniques such as visual detection of inclusion bodies, immunochemical detection of chlamydial antigen, or reverse transcriptase-PCR.

Antichlamydial Therapy Directed Toward the Initial Stage of Chlamydia Infection

A number of effective agents that are specifically directed toward the initial phase of chlamydial infection (i.e., transition of the chlamydial EB to an RB) have been identified. This "cryptic" growth phase, unlike that of the replicating chlamydial microorganism, which uses host cell energy, involves electrons and electron transfer proteins, as well as nitroreductases. Based upon this, it has been discovered that the initial phase of Chlamydia infection is susceptible to the antimicrobial effects of nitroimidazoles, nitrofurans and other agents directed against anaerobic metabolism in bacteria.

Nitroimidazoles and nitrofurans are synthetic antimicrobial agents that are grouped together because both are nitro (NO2 --) containing ringed structures and have similar antimicrobial effects. These effects require degradation of the agent within the microbial cell such that electrophilic radicals are formed. These reactive electophilic intermediates then damage nucleophilic protein sites including ribosomes, DNA and RNA. Nitroimidazoles and nitrofurans currently are not considered to possess antimicrobial activity against members of the Chlamydia species. This lack of antimicrobial activity, however, is due to the fact that conventional susceptibility testing methods only test for effect on the replicating form of Chlamydia species.

Examples of suitable nitroimidazoles include, but are not limited to, metronidazole, tinidazole, bamnidazole, benznidazole, flunidazole, ipronidazole, misonidazole, moxnidazole, ronidazole, sulnidazole, and their metabolites, analogs and derivatives thereof. Metronidazole is most preferred. Examples of nitrofurans that can be used include, but are not limited to, nitrofurantoin, nitrofurazone, nifuirtimox, nifuratel, nifuradene, nifurdazil, nifurpirinol, nifuratrone, furazolidone, and their metabolites, analogs and derivatives thereof. Nitrofurantoin is preferred within the class of nitrofurans.

Throughout this application and for purposes of this invention, "metabolites") are intended to embrace products of cellular metabolism of a drug in the host (e.g., human or animal) including, but not limited to, the activated forms of prodrugs. The terms "analogs" and "derivatives" are intended to embrace isomers, optically active compounds and any chemical or physical modification of an agent, such that the modification results in an agent having similar or increased, but not significantly decreased, effectiveness against Chlamydia, compared to the effectiveness of the parent agent from which the analog or derivative is obtained. This comparison can be ascertained using the susceptability tests described herein.

Cells to be treated can already be cryptically infected or they can be subjected to stringent metabolic or environmental conditions which cause or induce the replicating phase to enter the cryptic phase. Such stringent conditions can include changing environmental/culturing conditions in the instance where the infected cells are exposed to .gamma.-interferon; or by exposing cells to conventional antimicrobial agents (such as macrolides and tetracyclines) which induce this cryptic phase of chlamydial infection in human host cells.

Novel Antichlamydial Therapy Directed Toward the Replicating and Cryptic Stationary Phases of Chlamydia Infection

A unique class of antichlarnydial agents that is effective against the replicating and cryptic stationary phases of Chlamydia (and possibly against some other stages of the cryptic phase) have been identified using the susceptibility tests described herein. This novel class of agents comprises ethambutol and isonicotinic acid congeners which include isoniazid (INH), isonicotinic acid (also known as niacin), nicotinic acid, pyrazinamide, ethionamide, and aconiazide; where INH is most preferred. Although these are currently considered effective only for mycobacterial infections, due in part to currently available susceptability testing methodologies, it has been discovered that these agents, in combination with other antibiotics, are particularly effective against Chlamydia. It is believed that the isonicotinic acid congeners target the constitutive production of catalase and peroxidase, which is a characteristic of microorganisms, such as mycobacteria, that infect monocytes and macrophages. Chlamydia can also successfully infect monocytes and macrophages.

Using INH to eradicate Chlamydia from macrophages and monocytes subsequently assists these cells in their role of fighting infection. However, these agents appear to be less effective, in vitro, against the cryptic phase. Thus, ethambutol, INH and other isonicotinic acid congeners ideally should be used in combination with agents that target other phases of the chlamydial life cycle. These isonicotinic acid congeners are nevertheless excellent agents for the long term therapy of chronic/systemic chlamydial infection generally, and in particular to chiamydial infection of endothelial and smooth muscle cells in human blood vessels.

INH and its congeners can be used to clear infection from monocytes and/or macrophages. When monocytes and macrophages are infected by Chlamydia, they become debilitated and cannot properly or effectively fight infection. It is believed that, if the chlamydial infection, per se, is cleared from these cells, then the monocytes and macrophages can resume their critical roles fighting chlamydial or other infection(s). Thus, patient responsiveness to combination therapy can be optimized by the inclusion of isonicotinic acid congeners. Accordingly, one aspect of the invention provides a specific method for reempowering monocytes or macrophages that have been compromised by a Chlamydia infection and, in turn, comprise treating the infection in other sites. Such compromised macrophages or monocytes can be activated by treating the chlamydial infection by contacting the infected macrophages and/or monocytes with an antichlamydial agent.

Therapy Directed Toward Elementary Bodies of Chlamydia

As discussed above, it has been discovered that adverse conditions, such as limited nutrients, antimicrobial agents, and the host immune response, produce a stringent response in Chlamydia. Such adverse conditions are known to induce stringent responses in other microorganisms (C. W. Stratton, In: Antibiotics in Laboratory Medicine, Fourth Edition. Lorian V (ed) Williams & Wilkins, Baltimore, pp 579-603 (1996)) and not surprisingly induce a stringent response in Chlamydia. This stringent response in Chlamydia alters the morphological state of the intracellular microorganism and creates dormant forms, including the intracellular EB, which then can cryptically persist until its developmental cycle is reactivated. Conversely, the host cell may lyse and allow the EBs to reach the extracellular milieu. Thus, it is necessary to utilize a combination of agents directed toward the various life stages of Chlamydia and, in particular, against the elementary body for successful management of infection.

During the unique chlamydial life cycle, it is known that metabolically-inactive spore-like EBs are released into the extracellular milieu. Although these released EBs are infectious, they may not immediately infect nearby susceptible host cells until appropriate conditions for EB infectivity are present. The result of this delay in infection is the extracellular accumulation of metabolically-inactive, yet infectious, EBs. This produces a second type of chlamydial persistance referred to herein as EB "tissue/blood load"). This term is similar in concept to HIV load and is defined herein as the number of infectious EBs that reside in the extracellular milieu. Direct microscopic visualization techniques, tissue cell cultures, and polymerase chain reaction test methods have demonstrated that infectious EBs are frequently found in the blood of apparently healthy humans and animals. This phenomenon is clearly of great clinical importance in chlamydial infections as these metabolically-inactive EBs escape the action of current antichlamydial therapy which is directed only against the replicating intracellular forms of Chlamydia. The presence of infectious extracellular EBs after the completion of short term. anti-replicating phase therapy for chlamydial infections has been shown to result in intracellular infection relapse. Thus, the duration and nature of antichlamydial therapy required for management of chlamydial infections is, in part, dictated by the extracellular load of EBs. For purposes of this invention, short term therapy can be approximately two to three weeks; long term therapy in contrast is for multiple months.

As described in previous sections. it is also believed that persistance of chlamydial infections, in part, may be due to the presence of cryptic forms of Chlamydia within the cells. This cryptic intracellular chlamydial form apparently can be activated by certain host factors such as cortisone (Yang et al., Infection and Immunity, 39:655-658 (1983); and Malinverni et al., The Journal of Infectious Diseases, 172:593-594 (1995)). Antichlamydial therapy for chronic Chlamydia infections must be continued until any intracellular EBs or other intracellular cryptic forms have been activated and extracellular EBs have infected host cells. This reactivation/reinfection by chlamydial EBs clearly is undesirable as it prolongs the therapy of chlamydial infections, as well as increases the opportunity for antimicrobial resistance to occur.

Physiochemical agents have been identified that can inactivate chlamydial EBs in their respective hosts by reducing disulfide bonds which maintain the integrity of the outer membrane proteins of the EBs. For Chlamydia, disruption of the outer membrane proteins of EBs thereby initiates the transition of the EB form to the RB form. When this occurs in the acellular milieu where there is no available energy source, the nascent RB perishes or falls victim to the immune system. Thus, disulfide reducing agents that can interfere with this process are suitable as compounds for eliminating EBs.

One such class of disulfide reducing agents are thiol-disulfide exchange agents. Examples of these include, but are not limited to, 2,3-dimercaptosuccinic acid (DMSA; also referred to herein as "succimer"); D,L,-.beta.,.beta.-dimethylcysteine (also known as penicillamine); .beta.-lactam agents (e.g., penicillins, penicillin G, ampicillin and amoxicillin, which produce penicillamine as a degradation product), cycloserine, dithiotreitol, mercaptoethylamine (e.g., mesna, cysteiamine, dimercaptol), N-acetylcysteine, tiopronin, and glutathione. A particularly effective extracellular antichlamydial agent within this class is DMSA which is a chelating agent having four ionizable hydrogens and two highly charged carboxyl groups which prevent its relative passage through human cell membranes. DMSA thus remains in the extracellular fluid where it can readily encounter extracellular EBs. The two thiol (sulfhydryl) groups on the succimer molecule (DMSA) are able to reduce disulfide bonds in the MOMP of EBs located in the extracellular milieu.

Penicillamine can also be used as a disulfide reducing agent to eliminate chlamydial EBs. However, the use of penicillamine may cause undesirable side effects. Thus, as an alternative, those .beta.-lactam agents which are metabolized or otherwise converted to penicillamine-like agents in vivo (i.e., these agents possess a reducing group) can be orally administered to the human or animal as a means of providing a controlled release of derivative penicillamine, by non-enzymatic acid hydrolysis of the penicillin, under physiologic conditions. Clavulonic acid is not required for this hydrolysis or for using .beta.-lactam agents to create penicillamine in vivo.

Currently Recognized Agents Active Against Chlamydia Replication

As chlamydial RBs transform into EBs, they begin to utilize active transcription of chlamydial DNA and translation of the resulting mRNA. As such, these forms of Chlamydia are susceptible to currently used antimicrobial agents. The antichlamydial effectiveness of these agents can be significantly improved by using them in combination with other agents directed at different stages of Chlamydia life cycle, as discussed herein.

Classes of suitable antimicrobial agents include, but are not limited to, rifamycins (also known as ansamacrolides), quinolones, fluoroquinolones, chloramphenicol, sulfonamides/sulfides, azalides, cycloserine, macrolides and tetracyclines. Examples of these agents which arc members of these classes, as well as those which are preferred, are illustrated below in Table 5.

 

                             TABLE 5
             Agents Effective Against the Replicating
                        Phase of Chlamydia
        Drug Class        Examples          Preferred
        Quinolones/       Ofloxacin         Levofloxacin
        Fluoroquinolones  Levofloxacin
                          Trovafloxacin
                          Sparfloxacin
                          Norfloxacin
                          Lomefloxacin
                          Cinoxacin
                          Enoxacin
                          Nalidixic Acid
                          Fleroxacin
                          Ciprofloxacin
        Sulfonamides      Sulfamethoxazole  Sulfamethoxazole/
                                            Trimethoprim
        Azalides          Azithromycin      Azithromycin
        Macrolides        Erythromycin      Clarithromycin
                          Clarithromycin
        Lincosamides      Lincomycin
                          Clindamycin
        Tetracyclines     Tetracycline      Minocycline
                          Doxycycline
                          Minocycline
                          Methacycline
                          Oxytetracyline
        Rifamycins        Rifampin          Rifampin
        (Ansamacrolides)  Rifabutin


All members of the Chlamydia species, including C. pneumoniae, are considered to be inhibited, and some killed, by the use of a single agent selected from currently used antimicrobial agents such as those described above. However, using the new susceptability test, the inventors have found complete eradication of Chlamydia cannot be achieved by the use of any one of these agents alone because none are efficacious against all phases of the Chlamydia life cycle and appear to induce a stringent response in Chlamydia causing the replicating phase to transform into cryptic forms. This results in a persistent infection in vivo or in vitro that can be demonstrated by PCR techniques which assess the presence or absence of chlamydial DNA. Nevertheless, one or more of these currently used agents, or a new agent directed against the replicating phase of Chlamydia, should be included as one of the chlamydial agents in a combination therapy in order to slow or halt the transition of the EB to the RB as well as to inhibit chlamydial replication.

Methodology for Selecting Potential Agent Combinations

In attempting to manage or eradicate a systemic infection, it is critical to target multiple phases in the life cycle of Chlamydia, otherwise viable Chlamydia in the untargeted phases will remain after therapy and result in continued, chronic infection. This fundamental insight is at the core of this invention.

A preferred method for selecting an appropriate combination of agents that satisfies the requirements of this strategy comprises a plurality of steps as follows:

1. Identify the phases of the chlamydial life cycle. For example, the following phases are currently known:

a. Elementary Body ("EB")--Extracellular or Intracellular. Intracellular EBs may represent a type of "cryptic phase".

b. EB to Reticulate Body ("RB") transition phase.

c. Stationary RB phase. This is what is traditionally thought of as the "cryptic phase".

d. Replicating RB phase.

e. RB to EB transition phase (also called "condensation").

2. Evaluate the relative importance of targeting each particular phase in eradicating reservoirs of Chlamydia from the host organism. For example, the life-cycle stages listed in step 1 can be prioritized based on the following assumptions:

a. In the host, Extracellular and intracellular EBs represent a very important reservoir of infectious agents that result in chronic and and persistent infection.

b. Most intracellular RBs in chronic infections are non-replicating. The 3-4 day reproduction cycle seen in cycloheximide-treated eukaryotic cells is an artifact of an atypical, cell culture environment designed primarily to propagate Chlamydia.

c. The transition phases represent only a small portion of Chlamydia in chronic infections.

3. Identify "targets" for each phase of the selected life cycle phases. A target is an attribute of Chlamydia which is vulnerable during a particular life cycle phase. For example, the disulfide bonds in MOMP are a target during the EB phase.

4. Identify agents with known or theoretical mechanism(s) of action against those targets.

5. Estimate whether those agents would be merely inhibitory or, preferably, cidal, through an understanding of their mechanism of action.

6. Confirm the estimate by using the following approaches:

a. In the case of anti-EB agents, treat EBs with the agent, then attempt to infect cells with the treated EBs. If the cells do not become infected, the agent is EB-cidal.

b. In the case of other agents, use the susceptibility tests disclosed elsewhere herein, to determine whether the agent, either alone or in combination with other agents, is chlamydicidal.

7. Select a combination of agents that, through their individual effects, provide activity against targets for the most important phases within the chlamydial life cycle. Preferably, a combination should target as many phases of the life cycle as possible, seeking to maximize the total of the relative important scores of the phases targeted while minimizing the number of drugs involved.

8. Test the combination using the susceptibility testing procedures described elsewhere. This step is necessary because the selected combination may or may not be chlamydicidal for various reasons such as intracellular penetration and/or efflux.

9. Set initial dosages based on clinical standards which consider the pharmacokenetics and pharmacodynamics for the drugs prescribed individually; modifications, if needed, are based on results of susceptibility testing and in vivo efficacy.

Table 6 provides an example of how the foregoing methodology can be used. The preferred embodiment includes agents which:

a) Target disulfide bonds in the EB and condensation phases;

b) Target non-oxidative metabolism in the stationary/cryptic phase;

c) Target constitutive production of peroxidases and catalyses in the stationary and replicative phases;

d) In the latter two cases, work through physio-chemical disruption of the organism through free radicals, which are very difficult for organism to develop resistance to; and

e) Optionally adds an agent to target DNA-dependent RNA polymerase in the EB.fwdarw.RB phase.

The foregoing methodology for selecting combination therapies can be automated (e.g., by a computer system) at one or a combination of the steps described above. This methodology is applicable even after greater understanding of the chlamydial life cycle leads to a re-prioritization or even sub-division of the life-cycle phases, new theoretical targets within Chlarnydia are identified, or new drugs are developed which attack currently known or new targets within Chlamydia. For example, the phases of the life cycle could be further sub-classified based on the type of host cell the phase is in. Thus, stationary phase RBs in macrophages could be considered a separate phase than stationary phase RBs in hepatocytes. This allows the methodology to be used to design a single or multi-tissue specific combination of agents.

 

                                                            TABLE 6
    Example of using Theoretical Effect on Various Targets within the
     Chlamydialc Life Cycle to Pick a Combination Therapy
    Potentially                                     Constituitive
         DNA-                    Ribosomes
    vulnerable                                      production of
         dependent               involved in
    attributes of     Disulfide     Non-oxidative   peroxidases and
         RNA         Folic acid  protein
    Chlamydia:        bonds         metabolism      catalyses
     Topoisomerases  polymerase  pathway     synthesis     . . .
                                          Relative
    Phase in Chlamydial
                                            Impor-
    Life Cycle                                             Theoretical Targets
                                          tance
    EB (Extracellular or X
                                                  8
    Intracellular)
    EB->RB Transition               p                               p
            X                                     6
    Stationary Phase RB               X               X               p
           p           p           p             8
    ("Cryptic phase")
    Replicating RB                  p               X               X
         p           X           X             7
    RB->EB Transition X             p                               p
                                                  6
    ("Condensation")
    Pharmaceutical
    Compounds
    Non-Novel Classes                                               Quinolones,
         Rifamycins  Sulfona-    Azalides,
     Fluroquinolones             mides       Macrolides,
                                 Lincosamides,
                                 Tetracyclines
    Novel Classes     Disulfide     Agents that strip Agents activated
                      reducing agents electrons from  by peroxidases
                                    carrier proteins and catalyses to
                                    and become free- become free-
                                    radicals        radicals
    Examples:         Thiol-disulfide Nitroimidazoles Isonicotinic acid
                      reducing agents & Nitrofurans   cogeners
    Drugs of Choice   Penicillamine Metronidazole or INH
     Levofloxacin    Rifampin    Sulfa-      Azythromycin
    (based on         (from         Nitrofurantoin
     Trovafloxavin               methoxizole/ Clarithromycin
    effectiveness)    Amoxicillan)
                     trimethoprim Minocycline
    Preferred         Penicillamine Metronidazole   INH
         .+-.Rifampin
    Embodiment        (Amoxicillan)
    X = known target relevant to that life phase;
    p = possible target relevant to that life phase

Diseases Associated with Chlamydial Infection

An association has been discovered between chronic Chlamydia infection of body fluids and/or tissues with several disease syndromes of previously unknown etiology in humans which respond to unique antichlamydial regimens described herein. To date, these diseases include Multiple Sclerosis (MS), Rheumatoid Arthritis (RA), Inflammatory Bowel Disease (IBD), Interstitial Cystitis (IC), Fibromyalgia (FM), Autonomic nervous dysfunction (AND, neural-mediated hypotension); Pyoderma Gangrenosum (PG), Chronic Fatigue (CF) and Chronic Fatigue Syndrome (CFS). Other diseases are under investigation. Correlation between Chlamydia infection and these diseases has only recently been established as a result of the diagnostic methodologies and combination therapies described herein.

Based on this evidence, published evidence of an association between atherosclerosis and Chlamydia (Grupta el al, Circulation 96:404-407 (1997)), and an understanding of the impact Chlamydia infections have on infected cells and the immune systems, the inventors have discovered a connection between Chlamydia and a broad set of inflammatory, autoimmune, and immune deficiency diseases. Thus, the invention describes methods for diagnosing and/or treating disease associated with Chlamydia infection, such as autoimmune diseases, inflammatory diseases and diseases that occur in immunocompromised individuals by diagnosing and/or treating the Chlamydia infection in an individual in need thereof, using any of the assays or therapies described herein. Progress of the treatment can be evaluated serologically, to determine the presence or absence of Chlamydia using for example the diagnostic methods provided herein. and this value can be compared to serological values taken earlier in the therapy. Physical improvement in the conditions and symptoms typically associated with the disease to be treated should also be evaluated. Based upon these evaluating factors, the physician can maintain or modify the antichlamydial therapy accordingly. For example, the physician may change an agent due to adverse side-effects caused by the agent, ineffectiveness of the agent, or for other reason. When antibody titers rise during treatment then alternate compounds should be substituted in order to achieve the lower antibody titers that demonstrate specific susceptability of the Chlamydia to the new regimen. A replacement or substitution of one agent with another agent that is effective against the same life stage of Chlamydia is desirable.

The therapies described herein can thus be used for the treatment of acute and chronic immune and autoimmune diseases when patients are demonstrated to have a Chlamydia load by the diagnostic procedures described herein which diseases include, but are not limited to, chronic hepatitis, systemic lupus erythematosus, arthritis, thyroidosis, scleroderma, diabetes mellitus, Graves' disease, Beschet's disease and graft versus host disease (graft rejection). The therapies of this invention can also be used to treat any disorders in which a chlamydial species is a factor or co-factor.

Thus, the present invention can be used to treat a range of disorders in addition to the above immune and autoimmune diseases when demonstrated to be associated with chlamydial infection by the diagnostic procedures described herein; for example, various infections, many of which produce inflammation as primary or secondary symptoms, including, but not limited to, sepsis syndrome, cachexia, circulatory collapse and shock resulting from acute or chronic bacterial infection, acute and chronic parasitic and/or infectious diseases from bacterial, viral or fungal sources, such as a HIV, AIDS (including symptoms of cachexia, autoimmune disorders, AIDS dementia complex and infections) can be treated, as well as Wegners Granulomatosis.

Among the various inflammatory diseases, there are certain features of the inflammatory process that are generally agreed to be characteristic. These include fenestration of the microvasculature, leakage of the elements of blood into the interstitial spaces, and migration of leukocytes into the inflamed tissue. On a macroscopic level, this is usually accompanied by the familiar clinical signs of erythema, edema, tenderness (hyperalgesia), and pain. Inflammatory diseases, such as chronic inflammatory pathologies and vascular inflammatory pathologies, including chronic inflammatory pathologies such as aneurysms, hemorrhoids, sarcoidosis, chronic inflammatory bowel disease, ulcerative colitis, and Crohn's disease and vascular inflammatory pathologies, such as, but not limited to, disseminated intravascular coagulation, atherosclerosis, and Kawasaki's pathology are also suitable for treatment by methods described herein. The invention can also be used to treat inflammatory diseases such as coronary artery disease, hypertension, stroke, asthma, chronic hepatitis, multiple sclerosis, peripheral neuropathy, chronic or recurrent sore throat, laryngitis, tracheobronchitis. chronic vascular headaches (including migraines, cluster headaches and tension headaches) and pneumonia when demonstrated to be pathogenically related to Chlamydia infection.

Treatable disorders when associated with Chlamydia infection also include, but are not limited to, neurodegenerative diseases, including, but not limited to, demyelinating diseases, such as multiple sclerosis and acute transverse myelitis; extrapyramidal and cerebellar disorders, such as lesions of the corticospinal system; disorders of the basal ganglia or cerebellar disorders; hyperkinetic movement disorders such as Huntington's Chorea and senile chorea; drug-induced movement disorders, such as those induced by drugs which block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; Progressive supranucleo palsy; Cerebellar and Spinocerebellar Disorders, such as astructural lesions of the cerebellum; spinocerebellar degenerations (spinal ataxia, Friedreich's ataxia, cerebellar cortical degenerations. multiple systems degenerations (Mencel, Dejerine-Thomas, Shi-Drager, and Machado Joseph)); and systemic disorders (Refsum's disease, abetalipoprotemia, ataxia, telangiectasia, and mitochondrial multi-system disorder); demyelinating core disorders, such as multiple sclerosis, acute transverse myelitis; disorders of the motor unit, such as neurogenic muscular atrophies (anterior horn cell degeneration, such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy and juvenile spinal muscular atrophy); Alzheimer's disease; Down's Syndrome in middle age; Diffuse Lewy body disease; Senile Dementia of Lewy body type; Wernicke-Korsakoff syndrome; chronic alcoholism; Creutzfeldt-Jakob disease; Subacute sclerosing panencephalitis, Hallerrorden-Spatz disease; and Dementia pugilistica, or any subset thereof.

It is also recognized that malignant pathologies involving tumors or other malignancies, such as, but not limited to leukemias (acute, chronic myelocytic, chronic lymphocytic and/or myelodyspastic syndrome); lymphomas (Hodgkin's and non-Hodgkin's lymphomas, such as malignant lymphomas (Burkitt's lymphoma or Mycosis fungoides)); carcinomas (such as colon carcinoma) and metastases thereof; cancer-related angiogenesis; infantile hemangiomas; alcohol-induced hepatitis. Ocular neovascularization, psoriasis, duodenal ulcers, angiogenesis of the female reproductive tract, can also be treated when demonstrated by the diagnostic procedures described herein to be associated with Chlamydial infection.

An immunocompromised individual is generally defined as a person who exhibits an attenuated or reduced ability to mount a normal cellular or humoral defense to challenge by infectious agents, e.g., viruses, bacterial, fungi and protozoa. Persons considered immunocompromised include malnourished patients, patients undergoing surgery and bone narrow transplants, patients underoing chemotherapy or radiotherapy, neutropenic patients, HIV-infected patients, trauma patients, burn patients, patients with chronic or resistant infections such as those resulting from myeloodysplastic syndrome, and the elderly, all of who may have weakened immune systems. A protein malnourished individual is generally defined as a person who has a serum albumin level of less than about 3.2 grams per deciliter (g/dl) and/or unintentional weight loss greater than 10% of usual body weight.

The course of therapy, serological results and clinical improvements from compassionate antichlamydial therapy in patients diagnosed with the diseases indicated were observed and are reported in Example 5. The data provides evidence to establish that treatment of Chlamydia infection results in the serological and physical improvement of a disease state in the patient undergoing combination therapy. These observations were consistent among a variety of different diseases which fall within a generalized disease class.

Other Diseases of Unknown Etiology with New Evidence for a Chlamydia Pneumoniae Etiology

Both C. trachomatis and C. psittaci exhibit a protean disease complex dependent on different serovars. One known basis for this diversity to date is the amino acid sequence of the MOMP. FIG. 1 shows a sequence alignment of various Chlamydia MOMPs. Note that the size and sequence are relatively homologous except for the four variable regions that are responsible for the serovar (serotype) basis of classification. Further, it has been discovered that C. pneumoniae infects blood vessel endothelial cells from which EBs are released in the blood stream. In addition, macrophages are known targets for C. pneumoniae and may serve as reservoirs and provide an additional mechanism of transmission. C. pneumoniae is thus able to spread throughout the human body, establishing infection in multiple sites and in multiple organ systems. Infected sites may exist for an extended period without inducing symptoms that are noticed by the patient or by an examining physician. Sequence variability of MOMPs or other chlamydial antigens may provide a basis for organ specificity while other chlamydial proteins, such as the 60K and 70K heat shock proteins or LPS, may influence immune response.

C. psittaci and C. pecorum are known to cause a host of infections in economically significant animals. Thus, the teachings of this invention are relevant to animals. Throughout this application and for purposes of this invention, "patient" is intended to embrace both humans and animals. Virtually all rabbits and mice tested to date have PCR signals for C. pneumoniae. They can be used as appropriate animal models for treatment using specific combination antibiotics to improve therapy. (Banks et al., Ameri. J. of Obstetrics and Gynecology 138(7Pt2):952-956 (1980)); (Moazed et al., Am. J. Pathol. 148(2):667-676 (1996)); (Masson et al., Antimicrob. Agents Chemother. 39(9):1959-1964 (1995)); (Patton et al., Antimicrob. Agents Chemother. 37(1):8-13 (1993)); (Stephens et al., Infect. Immun. 35(2):680-684 (1982)); and (Fong et al., J. Clin. Microbiol. 35(1):48-52 (1997)).

Coupled with these developments are the recently developed rabbit models of coronary artery disease, where rabbits exposed to C. pneumoniae subsequently develop arterial plaques similar to humans (Fong et al., J. Clin. Microbiol. 35:48-52 (1997)). Most recently, a study at St. George's Hospital in London found that roughly 3/4 of 213 heart attach victims have significant levels of antibodies to C. pneumoniae antibody and that those that have such antibodies achieve significantly lower rates of further adverse cardiac events when treated with antibiotics (Gupta et al., Circulation 95:404-407 (1997)). Taken together, these three pieces of evidence (the bacteria found in diseased tissue, inoculation with the bacteria causes diseases, and treating for the bacteria mitigates disease) make a case for a causal connection.

Adjunct Agents Used in Conjunction with the Combination Therapy

In addition to the combination therapies discussed above, other compounds can be co-administered to an individual undergoing antichiamydial therapy for the management of chronic/systemic infection. For example, it may be desirable to include one or a combination of anti-inflammatory agents and/or immunosuppressive agents to amelioriate side-effects that may arise in response to a particular antichlamydial agent, e.g., Herxheimer reactions. Initial loading with an anti-inflammatory steroid can be introduced to minimize side-effects of the antichlamydial therapy in those patients in which clinical judgment suggests the possibility of serious inflammatory sequelae.

Suitable anti-inflarnmatory agents (steroidal and nonsteroidal agents) include, but are not limited to, Prednisone, Cortisone. Hydrocortisone and Naproxin. Preferably the anti-inflammatory agent is a steroidal agent, such as Prednisone. The amount and frequency of administration of these adjunct compounds will depend upon patient health, age, clinical status and other factors readily apparent to the medical professional.

Vitamin C (2 gms bid) has also been introduced based on the report that Vitamin C (ascorbic acid) at moderate intracellular concentrations stimulates replication of C. trachomatis (Wang el al., J. Clin. Micro. 30:2551-2554 (1992)) as well as its potential effect on biofilm charge and infectivity of the bacterium and specifically the EB (Hancock, R. E. W., Annual Review in Microbiology, 38:237-264 (1984)).

Additionally, probenicid can optionally be added to the therapy as an enhancer. Probenecid is known to increase plasma levels of penicillins by blocking the uricosuric and renal tubular secretion of these drugs.

Diagnosis and Treatment of Secondary Porphyria

Chlamydia is a parasite of normal energy production in infected eukaryotic cells. As a result, host cells have insufficient energy available for their normal functioning. The energy shortage also causes the host cell mitochondria to attempt to synthesize certain critical enzymes involved in energy production in order to increase energy production. Because Chlamydia also prevents this synthesis from completing, these enzyme's precursors, called porphyrins, build up in cell and often escape into the intracellular mileau. Porphyrins readily form free-radicals. that, in turn, damage cells. Thus, there is an obligate secondary porphyria that accompanies many chiamydial infections. Therapy for this secondary porphyria, which is adjunct to anti-chlamydial therapy, involves at least three strategies: a) supplement the cellular energy supply to mitigate cell malfunction and the formation of porphyrins; b) reduce the levels of systemic porphyrins; and c) mitigate the harmful effects of the porphyrins.

The pathogenesis of chronic/systemic chlamydial infection is unique in that the intracellular infection by this parasite results in a number of heretofore unrecognized concomitant and obligatory metabolic/autoimmune disorders including secondary porphyria with associated autoantibodies against the porphyrins. Cross reaction with Vitamin B12 can result in a subclinical autoimmune-mediated Vitamin B12 deficiency. These associated disorders often require diagnosis and preventive and/or specific adjunctive therapy.

The first of these concomitant disorders is a porphyria which is a direct result of the chlamydial infection of host cells. This form of porphyria is a secondary porphyria as it is not the result of a genetic deficiency of the enzymes involved in the biosynthesis of heme. Based upon the discovery of this secondary form of porphyria, a unique approach for the diagnosis and treatment of obligatory and secondary disorders caused by Chlamydia infections has been developed. The adjunctive therapy described herein can be used in combination with the appropriate antimicrobial therapy required for eradication of the pathogen. This adjunctive therapy for secondary porphyria is particularly important for long-term antimicrobial therapy of chronic/systemic infections as such therapy often evokes symptoms of secondary porphyria.

The discussion below outlines the believed mechanism by which Chlamydiae induce these secondary metabolic disorders. The phrase "chlamydial-induced porphyria" is defined herein as an obligatory and secondary metabolic disorder which is the direct result of a chlamydial infection and which may find clincially relevant phenotypic expression requiring interventional therapy.

Chlamydiae are prokaryocytes that develop in eukaryotic cells and utilize part of the host cell metabolism (Becker, Y., Microbiological Reviews, 42:247-306 (1978); McClairty, G., Microbiology, 2:157-164(1994)). The transition of elementary bodies (EBs) to reticulate bodies (RBs) for Chlamydia species requires the presence of functioning mitochondria in the infected cell as well as the production by the host cell of nucleoside triphosphates which are needed for chlamydial biosynthesis of nucleic acids (Becker, Y., Microbiological Reviews, 42:247-306 (1978); McClairty, G., Microbiology, 2:157-164(1994); Ormsbee, R. A. and Weiss, E., Science, 2:1077 (1963); Weiss, E., Jour. of Bacteriology, 90:243-253 (1965); Weiss, E. and Kiesow, L. A., Bacteriology Proceedings, 85 (1966); Weiss, E. and Wilson, N. N., Jour. of Bacteriology, 97:719 (1969); Hatch et al., Jour. of Bacteriology, 150:662-670 (1985)). Chlamydiae are known to possess fragments of the glycolytic, pentose phosphate, and citric acid pathways and appear to be capable of converting glucose-6-phosphate (but not glucose) to pyruvate and pentose (Ormsbee, R. A. and Weiss, E., Science, 2:1077 (1963); Weiss, E. and Kiesow, L. A., Bacteriology Proceedings, 85 (1966)). However, Chlamydiae seem to lack enzymes needed for the net generation of adenosine triphosphate (ATP)(Weiss, E., Jour. of Bacteriology, 90:243-253 (1965)). Thus. chlamydial development is dependent on active mitochondrial and nuclear function of the host cell. For this reason, Chlamydiae are considered obligatory intracellular parasites (McClairty, G., Microbiology, 2:157-164(1994)). Chlamydial dependence on host cell energy must necessarily deplete the host cell's existing energy output at the net expense of depriving host cell biosynthetic pathways.

The requirement of an exogenous source of ATP and the presence of a specific ATP transport system in Chlamydiae have provided supporting evidence for the energy parasite concept (Hatch et al., Jour. of Bacteriology, 150:662-670 (1985)). This ATP transport system is an ATP-adenosine diphosphate (ADP) exchange mechanism (Peeling et al., Infect. and Immun., 57:3334-3344 (1989)) similar to that found in mitochondria (Penefsky, H. S. and Cross, R. L., Adv. Enzym. and Rel. Areas in Molec. Bio., 64:173-214 (1991)). Moreover, electron microscopic studies have shown that replicating Chlamydiae are always found in close proximity to mitochondria. Therefore, it has been suggested that Chlamydiae behave in the reverse manner of mitochondria in that mitochondria import ADP from the host cell cytoplasm and export ATP, while Chlamydiae import ATP and export ADP (Becker, Y., Microbiological Reviews, 42:247-306 (1978)).

The production of ATP within the mitochondria is powered by a mechanism called chemiosmotic coupling (Kalckar, H. M., Annu. Review of Biochem., 60:1-37 (1991); Lehninger, A. L., The Mitochondrion. Molecular Basis of Structure and Function, The Benjamin Company, Incorporated, New York; Slater, E. C., Europ. Journ. of Biochem., 166:489-504 (1987); Babcock, G. T. and Wickstrom, M., Nature, 356:301-309 (1992); Senior, A. E., Physiology Review, 68:177-231 (1988); Pedersen, P. I. and Carafoli, E., Trends in Biochem. Sci., 12:145-150 (1987); Pedersen, P. I. and Carafoli, E., Trends in Biochem. Sci., 12:145-150 (1987)). The citric acid cycle drives oxidation of NADH or FADH2, which, in turn, releases a hydride ion (H-), which is quickly converted to a proton (H+) and two high-energy electrons (2 e-). As the high-energy electron pair is transferred to each of these three multiprotein complexes, the protons produced pass freely from the mitochondria matrix to the intermembrane space via channels in complexes I, III and IV. Thus, the transfer of electrons from NADH down the electron transport chain causes protons to be pumped out of the mitochondrial matrix and into the intermembrane space. These protons then reenter the matrix through a specific channel in complex V. This proton gradient across the inner membrane results in the proton motive force which drives ATP synthesis.

Chlamydial ATPase in essence is competing for protons with host cell mitochondrial ATPase. This, of course, reduces the ATP produced by the mitochondria. A net reduction of ATP in the host cell mitochondria results in a concomitant lowering of the electron transfer in the host cell mitochondria because electron transfer and ATP synthesis are obligatorily coupled; neither reaction occurs without the other. The establishment of a large electrochemical proton gradient across the inner mitochondrial membrane halts normal electron transport and can even cause a reverse electron flow in some sections of the host cell respiratory chain. The reduction of electron transfer in the host cell mitochondria, in turn, lowers the translocation and reduction of extramatrix mitochondrial ferric iron to intramatrix ferrous iron. This energy depletion, in turn, interferes with the biosynthesis of heme.

A. Biosynthesis of Heme

Heme is a Fe2+ complex in which the ferrous ion is held within the organic ligand, tetrapyrrolic macrocycle. The heme-containing tetrapyrrolic macrocyclic pigments are known as porphyrinogens and play a major role in cellular biochemistry. A number of critical cellular functions such as electron transport, reduction of oxygen, and hydroxylation are mediated by a family of heme-based cytochromes including catalase, peroxidase and superoxide dismutase. Moreover, the oxygen-carrying properties of hemoglobin and myoglobin are based on heme. Many cellular enzymes such as cytochrome P-450 and tryprophan pyrolase contain heme.

The biosynthesis of heme (Battersby et al., Nature, 285:17- (1980); Batterspy, A. R., Proceedings of the Royal Society of London, 225:1-26 (1985)) is an energy-dependent process which is adversely affected by depletion of host cell energy. The metabolic consequence of the interruption of heme biosynthesis is porphyria (Ellefson, R. D., Mayo Clinic Proceedings, 57:454-458 (1982); Hindmarsh, J. T., Clin. Chem., 32:1255-1263 (1986); Meola, T. and Lim, H. W., Bullous Diseases, 11:583-596 (1993); Moore, M. R., Int'l. Journ. of Biochem., 10:1353-1368 (1993)). Heme synthesis is a series of irreversible biochemical reactions of which some occur in the cell mitochondria and some in the cytoplasm. The intramitochondrial reactions are mainly oxidation-reduction while those in the cytosol are condensation and decarboxylation.

Porphyrinogens, porphyrins and porphyria are all related to heme synthesis. The biosynthesis of heme occurs in all human cells and involves a relatively small number of starting materials that are condensed to formn porphyrinogens; the porphyrins are formed from the porphyrinogens by non-enzymatic oxidation. As porphyrinogens progress through the heme biosynthesis pathway, the numbers of carboxyl side groups on the corresponding porphyrins decreases, as does the water solubility of the compounds.

The porphyrias are consequences of any impairment of the formation of porphyrinogens or in their transformation to heme. Porphyrins are formed from porphyrinogens by non-enzymatic oxidation. Each of the various genetic porphyrias is linked to an enzyme deficiency in the heme biosynthesis pathway. As a consequence of the enzyme defects, there is increased activity of the initial and rate-controlling enzyme of this biosynthesis pathway that results in overproduction and increased excretion of porphyrinogen precursors and porphyrinogens. The steps of heme biosynthesis are laid out in Table 7.

 

                             TABLE 7
           Simplified outline of enzymes and precursors
                   in the Biosynthesis of Heme
                       Other
    Enzyme             precursor   Inhibitor Resultb
                                             glycine and succinyl
                                             coenzyme A
    .DELTA.-ALA synthase pyridoxal   heme      delta-aminolevulinic
                       5'-phosphate           acid (.DELTA.-ALA)
    .DELTA.-ALA dehydratase*             lead and  porphobilinogen
                                   heme      (PBG)
    PBG deaminase*                           tetrapyrrole hydroxy-
                                             methylbilane
    uroporphyrinogen-III                       uroporphyrinogen-IIIa
    cosynthase*
    uroporphyrinogen                         7,6,5-carboxyl
    decarboxylase*                           porphyrinogen-III
    coproporphyrinogen                       coproporphyrino-
    oxidase                                  gen-III
    protoporphyrinogen                       protoporphyrinogen
    oxidase
    protoporphyrinogen                       protoporphyrin
    oxidase
    ferrochelatase     ferrous ion           heme
    a In absence of this step, the symmetric uroporphyrinogen-I is formed
    b Becomes precursor of the next step
    *Present in circulating red cells

When porphyrinogens accumulate due to enzymatic defects in the heme biosynthesis pathway, they are oxidized to photosensitizing porphyrins. Porphyrins are classified as photodynamic agents because they generally require superoxide/oxygen/electrons to exert their damaging biologic effects. Porphyrins may be converted from ground state to excited state molecules after absorption of radiation. Excited state porphyrins transfer energy to oxygen molecules and produce reactive oxygen species such as singlet oxygen, superoxide anion, super oxide radical, hydroxyl radical and hydrogen peroxide. Reactive oxygen species have been noted to disrupt membrane lipids, cytochrome P-450 and DNA structure. If these reactive oxygen species are released into the extracellular space, as seen in acute porphyria, autooxidation of surrounding tissue may result. Thus, the accumulation of porphyrinogens/porphyrins in human tissues and body fluids produces a condition of chronic system overload of oxidative stress with long term effects particularly noted for neural, hepatic and renal tissue.

B. Chlamydia and Secondary Porphyria

As mentioned, ferric/ferrous translocation is a critical step in the biosynthesis of heme as it catalyses the oxidative entry of coproporphyrinogen into the mitochondria matrix as protoporphyrin; Chlamydia interfere with this step by reducing electron transfer in the host cell. When coproporhyrinogen is unable to return to the mitochondrial matrix, it accumulates first in the cytosol and then in the extracellular milieu. Within the mitochondrial matrix, the final steps in the biosynthesis of heme are halted. Because the accumulation of heme within the mitochondrial matrix normally exerts a negative feedback on heme biosynthesis, the reduction of heme caused by the inability of coproporphyrinogen to return to the mitochondrial matrix results in the increased production of heme precursors such as .DELTA.-ALA and PBG, the first and second products in heme biosynthesis. Thus, porphyrin precursors such as .DELTA.-ALA and PBG begin to accumulate in the mitochondrial matrix, then in the cytosol, and then in the extracellular milieu.

Depletion of host cell energy by the intracellular infection with Chlamydia species causes additional energy-related complications. As fewer electrons are available to move through the electron transport chain of the host cell mitochondrial matrix membrane, the citric acid cycle produces more succinyl-CoA which, in turn, promotes increased synthesis of .DELTA.-ALA. The net result is an increased amount of heme precursors which become porphyrins. The presence of porphyrins in the mitochondrial matrix damages the cell as these molecules are unstable and form free radicals. The high energy electrons generated by these free radicals is "captured" by ubiquinone and cytochrome c which are present in the mitochondrial matrix membrane. This, of course, effectively uncouples electron transport from ATP synthesis and "short circuits" the proton-motice force: ATP synthesis is then reduced. Less ATP, in turn, means increased porphyrins and a destructive cycle is begun.

The clinical result of the intracellular and extracellular accumulation of porphyrins, if extensive, is a tissue/organ specific porphyria which produces many of the classical manifestations of hereditary porphyria. As the chlamydial-infected host cells lyse, as happens in the normal life cycle of Chlamydia, the intracellular porphyrins are released and result in a secondary porphyria. Moreover, when the chlamydial infection involves hepatic cells, the use of any pharmacologic agents that are metabolized by cytochrome P-450 in the liver will increase the need for cytochrome P-450, which is a heme-based enzyme. Hence, the biosynthesis of heme in the liver becomes increased. When hepatic cells are infected with Chlamydia species, the decreased energy in the host cell does not allow heme biosynthesis to go to completion and porphyrins in the liver/entero-hepatic circulation are increased. It also has been noted that any host cell infected with Chlamydia species has an increased amount of intracellular porphyrins that are released when antimicrobial agents kill the microorganism.

Although a number of investigators have reported enigmatic porphyria in patients who had no evidence of abnormal enzymes in the heme biosynthesis pathway (Yeung Laiwah et al., Lancet, i:790-792 (1983); Mustajoki, P. and Tenhunen, R., Europ. Journ. of Clin. Invest., 15:281-284 (1985)), the intrinsic secondary, obligatory porphyria caused by chlamydial infection disclosed herein has neither been described nor hypothesized in the medical literature. This obligatory secondary porphyria clearly is of paramount importance in dealing with chronic systemic chlamydial infections as are seen with intravascular infections caused by Chlamydia pneumoniae.

The diagnosis of chlarnydial-associated secondary porphyria is important because of the well known neuropsychiatiric manifestations of porphyrias (Gibson et al., Journal of Pathology and Bacteriology, 71:495-509 (1956); Bonkowsky et al., Seminars in Liver Diseases, 2:108-124 (1982); Brennan et al., International Journal of Biochemistry, 833-835 (1980); Burgoyne et al., Psychotherapy and Psychosomatics, 64:121-131 (1995)). Moreover, chronic exposure to excess porphyrins has been associated with cancer (Kordac V., Neoplasma, 19:135-139 (1972); Lithner et al., Acta Medica Scandanavia, 215:271-274 (1984)). Of particular interest is that infection with Chlamydia pneumoniae has been associated with lung cancer (Cerutti P A., Science, 227:375-381 (1985)).

The diagnosis of genetic porphyria in patients with systemic chlamydial infections is important as these patients may precipitate a severe porphyric attack when they receive antimicrobial agents to treat their infection. Thus, in order to control the severe porphyria, these patients may require intravenous hematin and/or plasmapheresis in addition to the oral anti-porphyric agents. In contrast, the diagnosis of chlamydial-associated secondary porphyria may be difficult as the porphyria may be minimal and tissue-specific. The measurement of 24 hour urine porphyrins is not sensitive enough in every case of chlamydial infection to detect the secondary porphyria caused by chlamydial infection.

In view of the foregoing discussion of the etiology of porphyria, one aspect of the invention pertains to methods for differentiating porphyria caused by Chlamydia from that caused by a latent genetic disorder in an individual. The method comprises treating infection by Chlamydia at all stages of its life cycle, using the therapies described in detail elsewhere in this disclosure, and then assessing whether symptoms of porphyria have been reduced. A reduction in the symptoms of porphyria (e.g., biochemical, enzymatic or physical manifestation) are indicative that the porphyria is a secondary porphyria caused by Chlamydia.

The diagnosis of genetic porphyria is most easily done during an acute porphyric attack as there are porphyrinogen precursors and porphyrins in the blood, urine and stool (Kauppinen et al., British Journal of Cancer, 57:117-120(1988)). The diagnosis of secondary porphyria is not as easy to do as there may not be an abnormal amount of porphyrinogen precursors and porphyrins in the blood, urine, or stool. However, several early enzymes in the pathway for heme biosynthesis can be readily measured in peripheral red blood cell (Percy et al., South African Forensic Medicine Journal, 52:219-222 (1977); Welland et al., Metabolism, 13:232-250 (1964); McColl et al., Journal of Medical Genetics, 19:271-276 (1982)). Specific hereditary porphyrias that can be diagnosed with the measurement of low levels of peripheral red blood cell enzymes are acute intermittent porphyria, congenital erythropoietic porphyria, .DELTA.-aminolevulinic acid dehydratase deficiency porphyria, and porphyria cutanea tarda. Therefore, elevated porphyrin levels in patients who do not have low levels of these enzymes is suggestive of a non-genetic porphyria, such as chlamydially induced secondary porphyria. For example, in one embodiment, porphyria caused by Chlamydia in an individual having symptoms associated therewith can be diagnosed by determining the presence and/or amount of obligatory enzymes in heme biosynthesis in red blood cells of the individual. The presence or amount of the obligatory enzyme is compared to a normal patient who does not have porphyria or to an earlier test result in the patient to determine the patient's porphyria symptoms and/or whether therapy is effective. For example, the presence of ALA synthase and/or PBF deaminase or any of the other known enzymes involved in heme biosynthesis (see Table 7), in abnormal levels (i.e., significant deviation from normal levels in healthy patients who do not have genetic porphyria) is indicative of secondary porphyria.

The diagnosis of chlamydial-associated secondary porphyria may be difficult as the porphyria may be minimal and tissue-specific. The measurement of 24 hour urine or stool porphyrins may not be sensitive enough in many cases of chlamydial infection to detect the secondary porphyria. Here, the diagnosis depends on the fact that if excess porphyrins are reaching the circulation, the precursor red blood cells will absorb these and make heme. Thus, the enzymes for heme biosynthesis in the differentiated red blood cell become elevated and remain elevated for the life of