Title:  Synthetic HIV-2 envelope genes containing modifications that lead to optimized expression in bacteria

United States Patent:  6,538,127

Issued:  March 25, 2003

Inventors:  Devare; Sushil G. (Northbrook, IL); Casey; James M. (Gurnee, IL); Desai; Suresh M. (Libertyville, IL)

Assignee:  Abbott Laboratories (Abbott Park, IL)

Appl. No.:  443530

Filed:  May 18, 1995

The present invention provides a method of synthesizing genes encoding unique HIV-1 and HIV-2 envelope proteins and their fragments, thereby allowing overexpression of these proteins in E. coli. The HIV envelope proteins and their fragments have been expressed at high levels as individual proteins or in fusion with other proteins. The HIV envelope proteins thus expressed in E. coli can be effectively used for the detection of exposure to HIV as well as the discrimination of HIV-1 and HIV-2.

DETAILED DESCRIPTION OF THE INVENTION

Synthetic DNA fragments of the HIV genome can be synthesized based on their corresponding amino acid sequences. By comparing the particular region of interest between different isolates, a sequence can be selected which is different from any sequence that exists in nature, because the sequence is a compilation of the sequences from various isolates. For example, the synthetic HIV-1 envelope protein described in Example 1, is based on the amino acid sequence of four different HIV 1 isolates, namely, HTLV-IIIB, LAV-1, ARV-2 and CDC-451.

Other properties can be built into the sequence. For example, codons can be switched for optimal expression in bacteria or yeast, specific restriction sites can be introduced, and other restriction sites can be removed. In addition, the sequence should have specific restriction sites at both 5' and 3' ends of the fragment to facilitate cloning in a particular vector. Synthetic DNA fragments can be synthesized as follows: (1) select an unique protein sequence, (2) reverse translate to determine complementary DNA sequence, (3) optimize codons for bacterial or yeast expression, and (4) introduce and/or remove specific restriction sites.

Sixty-one distinct nucleotide codons code for 20 amino acids giving rise to the degeneracy in the genetic code. Researchers have reported the frequencies of codons used in nucleic acids for both eukaryotic and prokaryotic organisms. (Grantham et al., Nucleic Acids Res. [1980] 9:r43; Gouy et al., Nucleic Acids Res. [1982] 10:7055; Sharp et al., Nucleic Acids Res. [1986] 14:7737.) Sequences from the entire E. coli genome, with examples of sequences from the chromosome, transposons, and plasmids, have been analyzed. These sequences code for structural proteins, enzymes and regulatory proteins. Correlation has been shown between the degree of codon bias within a particular gene and the level of gene expression.

It is preferred that the same codon triplet for each particular amino acid of the synthetic DNA sequence be used. However, alternative codon(s) can be used to add or delete a particular restriction site. The sequence should include unique restriction sites which can be used to delete a specific fragment or sequence, or substitute a particular sequence in case of an error in the original synthesis.

Vector systems which can be used include plant, bacterial, yeast, insect, and mammalian expression systems. It is preferred that the codons are optimized for expression in the system used. The proteins and polypeptides provided by the invention, which are cloned and expressed in heterologous systems, as described above, can be used for diagnostic and therapeutic purposes.

A preferred expression system utilizes the lambda pL vector system. This expression system has the following features: (1) a strong lambda pL promoter, (2) a strong three-frame translation terminator rrnBt1, and (3) translation starts at an ATG codon, eight base pairs from the ribosome binding site located within an accessible NcoI restriction site.

Another advantage of the expression system of the present invention is that one can customize the synthetic DNA fragments so they contain specific DNA sequences which express proteins with desired amino acid sequences, and further allows one the capability of adding, at either the 5' or 3+ end, other DNA sequences to facilitate the transfer of synthetic fragments into various vectors.

Additionally, the use of particular restriction sites at both ends of the fragment may also facilitate incorporation of the fragment into other sequences to generate fusion proteins, which can also be used as diagnostic and therapeutic reagents. For example, the HIV-1 gp41 sequence can be incorporated within or at the end of core/surface antigen of the hepatitis B viral sequence to generate a fusion protein which can be used in a single assay screening system for the detection of both AIDS and Hepatitis B in prospective blood donors. Alternatively, the assay can be used to track the course of a patient's infection.

Other proteins from any source, including bacterial, yeast, insect, plant or mammalian, can be used with the synthetic DNA fragments of the invention to produce fusion proteins. Those which are expressed efficiently in their respective expression systems are especially preferred because they can enhance the expression of the synthetic fragment of the fusion protein.

The synthetic DNA sequences of the present invention, derived from several HIV isolates and optimized for expression in E. coli provides continuous availability and uniformity of HIV antigen preparations which will recognize test sera from individuals exposed to genetically distinguishable variant HIV isolates. The recombinant antigen expression is very stable since E. coli codons have been used for its synthesis. Moreover, the insertion of specific restriction sites allows addition, deletion, or substitution in important antigenic epitopes in the coding sequences, a property difficult to achieve when naturally occurring HIV sequences are utilized for expression. Construction of synthetic genes also allows the addition of protein sequences at either amino- or carboxyl-terminus of the gene thereby allowing the development of novel reagents. For example, a fusion gene can be produced comprising a fusion between HIV-1 core antigen and HIV-1 envelope synthetic gene. More specifically the envelope synthetic gene comprises the carboxyl-terminus HIV-1 gp120 sequence and the full length HIV-1 gp41. Similarly, the HIV-1 core antigen DNA sequence can be fused to the HIV-2 gp41 sequences, both of which can be expressed at high levels in heterologous host systems such as E. coli.

E. coli strains containing plasmids useful for constructs of the invention have been deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., on Nov. 22, 1988, under the accession nos. ATCC 67855 (pSD301/RR1/pRK248.clts) and ATCC 67856 (pSD306/CAG456).

The following examples further describe the invention. The examples are not intended to limit the invention in any manner.

Reagents and Enzymes

Media such as Luria-Bertani (LB) and Superbroth II (Dri Form) were obtained from Gibco Laboratories Life Technologies, Inc., Madison, Wis. Restriction enzymes, Klenow fragment of DNA polymerase I, T4 DNA ligase, T4 polynucleotide kinase, nucleic acid molecular weight standards, M13 sequencing system, X-gal (5-bromo-4-chloro-3-indonyl-.beta.-D-galactoside), IPTG (isopropyl-.beta.-D-thiogalactoside), glycerol, Dithiothreitol, 4-chloro-1-napthol were purchased from Boehringer Mannheim Biochemicals, Indianapolis, Ind.; or New England Biolabs, Inc., Beverly, Mass.; or Bethesda Research Laboratories Life Technologies, Inc., Gaithersburg, Md. Prestained protein molecular weight standards, acrylamide (crystallized, electrophoretic grade >99%); N-N'-Methylene-bis-acrylamide (BIS); N,N,N',N',-Tetramethylethylenediamine (TEMED) and sodium dodecylsulfate (SDS) were purchased from BioRad Laboratories, Richmond, Calif. Lysozyme and ampicillin were obtained from Sigma Chemical Co., St. Louis, Mo. Horseradish peroxidase (HRPO) labeled secondary antibodies were obtained from Kirkegaard & Perry Laboratories, Inc., Gaithersburg, M., Seaplaque.RTM. (low melting agarose, available from FMC Bioproducts, Rockland, Me.

T50E10 contained 50 mM Tris, pH 8.0, 10 mM EDTA; 1.times.TG contained 100 mM Tris, pH 7.5 and 10% glycerol; 2.times.SDS/PAGE loading buffer consisted of 15% glycerol, 5% SDS, 100 mM Tris base, 1M .beta.-mercaptoethanol and 0.8% Bromophenol blue dye; TBS contained 50 mM Tris, pH 8.0, and 150 mM sodium chloride; Blocking solution consisted of 5% Carnation nonfat dry milk in TBS.

Host Cell Cultures. DNA Sources and Vectors

E. coli JM103 cells, pUC8, pUC18, PUC19 and M13 cloning vectors were purchased from Pharmacia LKB Biotechnology, Inc., Piscataway, N.J.; Competent Epicureans.TM. coli strains XL1-Blue and JM109 were purchased from Stratagene Cloning Systems, La Jolla, Calif. RR1 cells were obtained from Coli Genetic Stock Center, Yale University, New Haven, Conn.; and E. coli CAG456 cells from Dr. Carol Gross, University of Wisconsin, Madison, Wis. Vector pRK248.clts was obtained from Dr. Donald R. Helinski, University of California, San Diego, Calif.

General Methods

All restriction enzyme digestions were performed according to suppliers' instructions. At least 5 units of enzyme were used per microgram of DNA, and sufficient incubation was allowed to complete digestions of DNA. Standard procedures were used for mini cell lysate DNA preparation, phenol-chloroform extraction, ethanol precipitation of DNA, restriction analysis of DNA on agarose, and low melting agarose gel purification of DNA fragments (Maniatis et al., Molecular Cloning. A Laboratory Manual [New York: Cold Spring Harbor, 1982]). Plasmid isolations from E. coli strains used the alkali lysis procedure and cesium chloride-ethidium bromide density gradient method (Maniatis et al., supra). Standard buffers were used for T4 DNA ligase and T4 polynucleotide kinase (Maniatis et al., supra).

Claim 1 of 7 Claims

What is claimed is:

1. A HIV-2 synthetic gene comprising a DNA having the following sequence:

5'-TACTCTTCCGCTCACGGCCGTCACACCCGTGGCGTTTTCGTTCTGGGCTTCCTGG GCTTCCTGGCTACCGCGGGCTCCGCTATGGGCGCTGCTTCCCTGACCGTTTCCGCTCAGTCCCGTACCCT GCTGGCTGGCATCGTTCAGCAGCAGCAGCAACTTCTAGACGTTGTTAAACGTCAGCAGGAGCTCCTGCGT CTGACCGTTGGGGCACCAAAAACCTGCAGGCTCGTGTTACCGCTATCGAAAAATACCTGCAGGACCAGG CTCGTCTGQAATTCCTGGGGCTGCGCTTTCCGTCAGGTTTGCCACACCACCGTTCCATGG-3'.
 

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.