Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 

Title:  Single chain antibody against mutant p53

United States Patent:  6,630,584

Issued:  October 7, 2003

Inventors:  Solomon; Beka (Herzlia Pituach, IL); Cohen; Gerald (Raanana, IL); Govorko; Dimitri (Herzlia, IL)

Assignee:  Ramot at Tel-Aviv University Ltd. (Ramat-Aviv, IL)

Appl. No.:  526738

Filed:  March 16, 2000

Abstract

More than 90% of mutations found in the p53 protein produce a conformational change in p53 which results in the exposure of an epitope, which is otherwise hidden in the hydrophobic core of the molecule. A single chain antibody (scFv) which specifically recognizes this common mutant epitope in mutant p53 but not in wild type p53 is disclosed. Also described are a DNA molecule encoding the scFv, pharmaceutical compositions comprising the antibody and methods of treatment using the pharmaceutical compositions.

SUMMARY OF THE INVENTION

It is an object of the present invention to provide a single chain antibody which recognizes an epitope exposed on mutant, but not on wild-type, p53.

Thus, in a first aspect the present invention provides a DNA molecule encoding a single chain antibody (scFv) which specifically recognizes the common mutant epitope in mutant p53 but not in wild type p53.

In a preferred embodiment, the scFv is ME1.

In a most preferred embodiment, the DNA molecule of the invention comprises SEQ. ID. NO. 1.

In the present specification, the normally cryptic, mutant p53 epitope motif as described above (FRHSVV, SEQ ID NO:8) which is recognized by the Pab240 antibody (7) is termed the "common mutant epitope" of mutant p53. This epitope differs from the p53 epitopes recognized by, the previously disclosed scFv antibodies mentioned above.

In order to realize the object of the invention, the gene segments encoding variable parts of the antibody heavy and light chains were amplified by PCR from the spleen of the hyperimmunized mouse, and a library of the antibody genes was obtained. When the genes isolated from the antibody gene library were assembled in the scFv DNA, expressed as phage antibodies and subjected to panning, the single-chain scFv ME1 that was isolated possessed a significant affinity (10-7 M) towards mutant p53 and was successfully expressed as a soluble antibody, separate from the phage fusion.

Such libraries usually contain a large number of different genes encoding the antibodies specific to the chosen antigen, in contrast to a single pair (VH and VL) of antibody genes encoding a single antibody as present in hybridoma cells. This issue has a special importance for the amplification of mouse antibody genes because the sequencing of their repertoire has not yet been completed, and thus it is still not possible to design a primer set covering all existent antibody gene variants. Also, some single-chain antibody genes are difficult to express in bacterial cells for various reasons, among which are their toxicity for the host, low conformational stability and rapid proteolytic degradation. Thus, it appears that a much improved starting point for scFv construction is selecting from the collection of variants of the VH and VL domains present in the immunized host, than from a hybridoma cell line.

One or more nucleotides of the DNA molecule of the invention may be modified without affecting the ability of the antibody, encoded by the modified DNA molecule, to specifically recognize the common mutant epitope in mutant p53 but not in wild type p53. Such modifications are well known to the skilled man of the art, and include (1) substitutions, e.g. based on the degeneracy of the genetic code, and (2) insertions or deletions of nucleotide base triplets resulting in insertions to or deletions from the amino acid sequence of the scFv at non-essential locations. The modifications may be carried out by various techniques such as site-directed mutagenesis.

Codons preferred by a particular prokaryotic or eukaryotic host (Murray, E. et al. Nuc Acids Res., 17:477-508, (1989)) can be selected, for example, to increase the rate of variant product expression or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, than transcripts produced from naturally occurring sequence. In a further preferred embodiment of this aspect of the invention, the DNA molecule comprises SEQ. ID. NO: 3, which has been modified for eukaryotic expression.

The DNA sequence of the present invention can be engineered in order to alter a scFv product coding sequence for a variety of reasons, including but not limited to, alterations which modify the cloning, processing and/or expression of the product. For example, alterations may be introduced using techniques which are well known in the art, e.g., site-directed mutagenesis, to insert new restriction sites, to alter glycosylation patterns, to change codon preference, etc.

The invention also relates to a vector, such as a plasmid or viral vector, into which the DNA molecule of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. A preferred vector is the expression vector pIRES-EGFP-ME1.

The present invention also relates to host cells which are genetically engineered with vectors of the invention, and the production of the product of the invention by recombinant techniques. Host cells are genetically engineered (i.e., transduced, transformed or transfected) with the vectors of this invention which may be for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the expression of the variant nucleic acid sequence. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art. A preferred host cell is a mammallian host cell containing the pIRES-EGFP-ME1 vector.

In a second aspect, the invention provides a scFv molecule which specifically recognizes the common mutant epitope in mutant p53 but not in wild type p53.

In a preferred embodiment, the scFv is ME1.

In a most preferred embodiment, the scFv comprises the amino acid sequence SEQ. ID. NO. 2. In another preferred embodiment, the scFv comprises SEQ. ID. NO: 4.

One or more amino acids of the scFv of the invention may be modified without affecting the ability of the antibody to specifically recognize the common mutant epitope in mutant p53 but not in wild type p53. Such modifications are well known to the skilled man of the art, and include (1) substitutions, e.g. substituting hydrophilic or hydrophobic amino acids with other hydrophilic or hydrophobic amino acids, respectively, by site directed mutagenesis, (2) insertions or deletions of amino acids at non-essential locations, and (3) chemical modifications.

Thus, the invention also includes a polypeptide comprising a polypeptide sequence having at least a 95% sequence identity, and more preferably at least a 99% sequence identity, to SEQ. ID. NO. 2, wherein said polypeptide sequence specifically recognizes the common mutant epitope in mutant p53 but not in wild type p53.

The modifications of the DNA molecule or of the scFv molecule may be directed towards conferring upon the scFv polypeptide various characteristics such as (1) increased specificity for the mutant p53 molecule as compared to the wild type p53 molecule, (2) higher affinity for the mutant p53 antigen, (3) increased stability and resistance to proteolysis, (4) enhanced expression and solubility of the scFv antibody in vitro and in vivo, and (5) preferred targeting of the scFv antibody to sub-cellular sites by incorporation into the scFv antibody of, for example, ER and nuclear targeting peptide sequences, so as to generate preferred embodiments of the invention for pharmacological and pharmaceutical applications. An example of a domain of the scFv which may be modified is the CDR domain. These alterations can be achieved not only by the introduction of nucleotide changes in the cloned scFv antibody gene encoding the polypetide using commonly known methods of chemical and enzymatic mutagenesis, such as oligonucleotide-directed mutagenesis and PCR-based mutagenesis (see Current Protocol in Molecular Biology, John Wiley and Sons,Inc., 1997, Volume 1, section 8), but also by chemical changes in the amino acid sequence of the scFv, such as glycosylation and by the creation of polyvalent scFv antibodies (see Smythe J. A. et al., (1994) Protein Engineering 7:145-147).

The scFv antibody of the invention has distinct advantages over the existing monoclonal antibodies. Thus, the modifications outlined above can readily be made with the scFv antibody but not with the monoclonal antibody. The smaller size of the scFv is also an advantage in intracellular applications.

In a third aspect, the invention provides a pharmaceutical composition comprising either a DNA molecule, a vector, or an antibody molecule according to the invention, and a pharmaceutically acceptable excipient.

In a fourth aspect, the invention provides a method for treating a patient suffering from a disease whose etiology is related to a mutation in the p53 gene comprising administrating to said patient a pharmaceutical composition according to the invention.

The scFv of the invention may be useful in the treatment of a disease whose etiology is related to a mutation in the p53 gene, and in particular, in the treatment of cancer.

A novel and promising approach in the gene therapy of tumors lies in the intracellular expression of antibodies that are capable of inactivating certain oncogene products, or by targeting their degradation. Because mutant p53 exerts distinct oncogenic properties and appears in the cytosol of a wide range of tumors, an intracellularly expressed single-chain antibody (intrabody) directed against this protein may serve as a "broad spectrum" agent for tumor therapy. To adapt the ME1 scFv for conditions of intracytosolic mammalian expression, several modifications were introduced in the scFv DNA, as will be described more particularly below.

The scFv ME1 of the invention may serve as a powerful auxiliary agent capable of significantly enhancing the specificity and effectiveness of the two major existent anti-cancer gene therapies.

One of these strategies employs an overexpression of the wild-type p53 protein in cancer cells. In spite of the promising results obtained from several clinical trials utilizing this technique, it was recently found that cancer cells containing a mutant form of p53 are largely recalcitrant to this treatment. Expression of the scFv ME1 molecule as an intrabody fused to the F-box domain responsible for the targeting of the cell proteins to the degradation cascade may be capable of significantly reducing the level of mutant p53 in the cell, thereby broadening the range of possible tumor targets for the original therapy.

Another emerging anti-cancer gene therapy employs a single-chain antibody directed to a p53 protein epitope which is present both in wild-type and mutant p53 molecules. It forms a part of the synthetic transcription factor containing also the bacterial tetracycline repressor as a DNA binding domain. The strategy is based on the fact that the mutant form of p53 antibody serve as a tether bringing together a transactivation function provided by p53 and the DNA binding activity from the tetracycline receptor. The resultant complex can activate the transcription of the protein toxin put under control of the promoter containing tetracycline-operator sequences. The major drawback of this strategy is the indiscriminate nature of the antibody employed which causes an activation of toxin expression in a cell containing any form of p53 protein. As a consequence, only the local administration of this treatment can be considered as safe. The substitution of the original antibody by the scFv ME1 specific to the mutant form of p53 may restrict the therapeutic effect to cancer cells only, allowing a systemic application of this therapy.

In addition to its the clinical importance, the scFv ME1 antibody can serve as a valuable research and diagnostic tool, allowing specific tagging of mutant p53 molecules inside the cell. Mutation of the p53 gene results in stabilization of the protein and a subsequent increase in intracellular protein sufficient to be detectable by immunohistochemistry. The high specificity of the scFv of the invention towards a peptide epitope, which appears only in mutant variants of p53, the lack of the Fc portion which binds specifically to the antigen, and the high permeability of these small antibodies into cells, make the antibody of the invention a suitable probe for immunodiagnostic clinical detection of mutant p53 in tissues, using 20 conventional immunohistochemistry techniques. An immunodiagnostic kit could therefore be prepared comprising the scFv of the invention. Such kits using other antibodies for detecting other antigens are well known in the art.

DETAILED DESCRIPTION OF A PREFERRED EMBODIMENT

A. Material and Methods

I. Covalent-coupling of the Epitopic Peptide to Microtiter plates

Originally, the KFRHSVV, SEQ ID NO: 5 heptapeptide was obtained as a crude preparation after the peptide synthesis at Weizmann Institute. The N-terminal lysine (K) was added to the native hexapeptide sequence in order to facilitate a covalent coupling through an .epsilon.-amino group of the lysine to the active groups of the solid support.

Peptide purification was performed on the Gilson-301 HPLC chromatographer (Gilson, France) using the 5 .mu.m Lichrosorb RP-18 column (Dr. Herbert Knauer KG, Germany). 1 ml of 1 mg/ml solution of the crude peptide preparation was applied to the column pre-equilibrated with 0.1% trifluoroacetic acid in water (Solution A). The elution was carried out with a linear gradient of 0 to 100% of solution B (80% acetonitrile in solution A) for 70 min at flow rate of 1 ml/min. The effluent was monitored in UV light detector at 230 nm. The peak fractions were pooled and dried in a SpeedVac. The fractions that revealed the presence of the heptapeptide (as determined by amino acid analysis at Weizmann Institute) were selected for the subsequent work.

Covalent binding of the heptapeptide to microtiter plates. 96-wells microtiter plates (Nunc, Denmark) were coated with the epoxy-activated polymeric carrier Eupergit C (Rohm, Germany) according to the prescription of the manufacturer. 200 .mu.l of 0.2 M 1,4-Adipic acid dihydrazide (Sigma, USA) in 0.2 M carbonate buffer , pH 9.0 were added per well of the Eupergit C-coated plates. After 16 hours of incubation at room temperature, the plates were emptied, filled with 250 .mu.l of the blocking solution (0.2 M mercaptoethanol in PBS) per well and kept overnight at 4oC. At the next step, the blocking solution was removed and plates were activated by adding of 200 .mu.l per well of 25% glutaraldehyde solution in water (Merck, Germany) and incubating for 2 hours at room temperature. After removal of the glutaraldehyde solution, the activated plates were filled with 100 .mu.l per well of the purified peptide dissolved in PBS and incubated for 2 hours at room temperature. The wells content was replaced subsequently with 200 .mu.l of the blocking solution containing 1% of non-fat, dry milk and incubated overnight at 4oC. Following the incubation, the plates were washed thoroughly, dried, sealed under vacuum in the plastic bags and stored at -20oC.

The mutant p53 protein and BSA-heptapeptide conjugate were covalently bound to the Eupergit C-coated microtiter plates by incubation of the protein dissolved in 1M of Kpi (potassium-phosphate buffer, pH 8.0), followed by overnight incubation in the blocking solution at 4oC.

ELISA test. All ELISA tests in this project were performed in 96-wells microtiter plates (Costar). Border wells were excluded from the analysises. 100 .mu.l of primary antibodies were routinely applied to each well under the test. Primary antibodies were diluted two-fold either with PBS containing 10% of non-fat dry milk or BSA. The incubation conditions were 1 hour at 37oC. for the monoclonal antibody PAb 240 culture liquid supernatant, 2 hours at 37oC. or overnight at 4oC. for the phage antibody supernatant or periplasmic extract containing soluble antibodies.

To perform the competitive ELISA test, the diluted primary antibody was pre-incubated with the antigen for one hour at 37oC. with intermittent shaking. The horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG (Sigma, USA) antibody diluted 1:2500 or HRP-conjugated goat anti-M13 phage antibody diluted 1:5000 (Pharmacia, Sweden) were employed as a secondary antibody. The incubation conditions for a secondary antibody were one hour at 37oC. Between the incubations plates were washed four times in PBS containing 0.05% Tween 20 followed by four washes in PBS. To develop ELISA reaction, 30 .mu.g of o-phenylenediamine dihydrochloride (Sigma, USA) was dissolved in 15 ml of 0.05M citrate buffer, pH 5.0, combined with 4 .mu.l of 30% H2 O2 were applied in 100 .mu.l aliquotes to each well under the test. After developing of yellow color, the reaction was stopped by introducing 50 .mu.l of 4 N HCl into each well. The plates were scanned in the EasyReader 400 FW ELISA reader (SLT, Austria) at 492 nm with reference at 405 nm.

II. Cloning, Construction and Phage Display of scFv from the Spleen of Hyperimmunized Mouse

Immunization protocol--Five female BALB/c mice were immunized with the mutant p53 epitope peptide conjugated to BSA and boosted with the conjugate. To follow the course of the immunization, mice were bled and policlonal sera were prepared according to Harlow E. Lane D. (1988) Antibodies: Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, USA. Titers of the antibodies specific to the conjugated and non-conjugated heptapeptide were measured in ELISA assay as described in Section I.

Splenocite isolation--To obtain splenocites, a mouse with the highest specific antibody titer was sacrificed, its spleen was aseptically removed and cut into small pieces. 25 ml of sterile DMEM with high glucose (4.5 g/l) (Biological Industries (Israel)) supplemented with 10% heat inactivated (56oC., 30 min) horse-serum (Biological Industries, Israel), 4 mM L-glutamine (Biological Industries, Israel), 100 U/ml penicillin and streptomycin solution (Biological Industries, Israel) were added to the minced spleen and pipetted through a large-bore sterile pipet. The spleen cell suspension was transferred into a sterile 50 ml centrifuge tube and cells were pelleted at 800xg in a Sorvall GLC-4 centrifuge for 5 min. The supernatant was discarded and the cell pellet was stored at -70oC.

mRNA isolation--mRNA isolation from the splenocytes was accomplished with the help of the QuickPrep mRNA Purification Kit (Pharmacia, Sweden) according to the manufacturer's instructions.

III. Construction of the Single-chain Antibody (scFv)

A scFv gene fragment was constructed with the help of the Recombinant Phage Antibody System Kit (Mouse scFv Module) of Pharmacia (Sweden) according to manufacturer protocols.

First-Strand cDNA Synthesis--The RNA sample (OD260 -0.02 ) was spun for 10 min in a desktop centrifuge at -4oC. The precipitate was washed two times with cold (-20oC. ) 95% ethanol, dried and dissolved in 20 .mu.l of DEPC-treated water. Two aliquots (each of 5 .mu.l) of the mRNA solution were placed in 0.5 ml microcentrifuge tubes, heated at 65oC. for 10 min. For each aliquot the following reaction mixture was prepared in 0.5 ml tubes (one tube for the antibody light chain and another for the antibody heavy chain): 16 .mu.l of DEPC-treated water, 11 .mu.l of primed first-strand mix (recombinant Moloney Murine Leucosis Virus reverse transcriptase, random hexadeoxyribonucleotides, RNAguard, RNase/DNase-free BSA, dATP,dCTP,dGTP, and dTTP in aqueous buffer) and 1 .mu.l of 200 mM DTT solution. Aliquots of the mRNA were cooled briefly on ice after heating, added to the reaction mixture and incubated for 1 h at 37oC.

Primary PCR Amplification--The following mixtures were prepared in 0.5 ml tubes: for the light chain PCR--2 .mu.l of Light primer mix (mixture of 10 variable light chain primers in water) and 64 .mu.l of sterile distilled water; for the heavy chain PCR--2 .mu.l of Heavy primer 1 (upstream primer in water), 2 .mu.l of Heavy primer 2 (downstream primer in water) and 62 .mu.l of sterile distilled water. To each tube 33 .mu.l of first-strand reaction mixture were added and overlaid with 0.1 ml of mineral oil. The tubes were placed in a thermocycler and heated at 95oC. for 5 min. 1 .mu.l of AmpliTaq DNA polymerase of 5000 U/ml (Perkin-Elmer Cetus, USA) was added to each tube. The PCR reaction was run with a program as follows: 30 cycles -94oC. for 1 min; 55oC. for 2 min; 72oC. for 2 min.

Purification of Primary PCR Products--Purification of PCR products was performed by gel electrophoresis in 1.5% agarose gel (50 .mu.l of each PCR mixture per well). Molecular weight markers were 100 Base-Pair Ladder mixture 25 (Pharmacia, Sweden) and the HaeIII digest of .phi.174 RF (Eastman-Kodak, USA). The DNA bands of 340 and 325 bp (corresponding to heavy and light chain respectively) were excised and the DNA purified by Sephaglas Bandprep Kit (Pharmacia, Sweden). The DNA was dissolved in 20 .mu.l of Tris-HCl (pH 8.3), 0.1 M EDTA buffer (TE buffer) and stored at -20oC.

Gel quantitation of purified product and inner fragment--Aliquots (2 .mu.l) of each DNA sample and 2 .mu.l of Linker-Primer mix (equimolar mixture of 3' heavy and 5' light linker primers in water) were electrophoresed in 1.5% agarose. BstEIII digest and HindIII digests of lambda DNA were used as standards. Relative amounts of heavy and light chain products and the linker-primer DNA were estimated visually after staining with ethidium bromide solution.

Assembly and Fill-in Reactions--The following reaction mixtures were prepared in 0.5 ml tubes: 0.5 .mu.l of heavy chain product, 2 .mu.l of light chain product, 1 .mu.l of the linker-primer mix, 2.5 .mu.l of 10xPCR buffer, 1.25 .mu.l of dNTP Mix (20 mM each dNTP), 2.5 .mu.l of 25 mM MgCl2, 1 .mu.l of AmpliTaq DNA Polymerase and 9.25 .mu.l of sterile distilled water. The mixtures were overlaid with 25 .mu.l of mineral oil. The tubes were placed in a thermocycler and run with a program: 20 cycles -94oC. for 1 min; 63oC. for 4 min.

Second PCR Amplification and Purification--A 75 .mu.l mix was prepared containing 1.5 .mu.l of AmpliTaq DNA Polymerase, 7.5 .mu.l of 10xPCR buffer, 1.5 .mu.l of dNTP Mix, 6 .mu.l of RS Primer Mix (mixture of 5' heavy chain primer with SfiI site and 3' light chain primer with NotI site in water) and 58.5 ' of sterile distilled water. 25 .mu.l of the mix was added to the assembly reaction, overlaid with 25 .mu.l of mineral oil and run with the same program as above. After PCR 5 .mu.l aliquots of the mixtures were analysed by electrophoresis in 1.5% agarose with a BstEII digest of lambda DNA as a standard. The 750 bp DNA band was excised and the DNA product was purified by Sephaglas Bandprep Kit. The purified DNA sample was dissolved in 20 .mu.l of TE buffer and stored at -20oC.

PCR Amplification of Assembled Product--The following reaction mixture was prepared in three 0.5 ml tubes: 2 .mu.l of the assembled single-chain DNA product from the previous procedure, 4 .mu.l of RS primer Mix, 5 .mu.l of 10xPCR buffer, 2.5 .mu.l of dNTP mix, 5 .mu.l of MgCl2 solution (molarity of the solution was varied in different tubes) and 30.5 .mu.l of sterile distilled water (17). The molarity of the MgCl2 was varied as follows: 25 mM, 45 mM and 85 mM. Each mixture was overlaid with 50 .mu.l of mineral oil and the tubes placed in a thermocycler for 5 min at 95oC. 1 .mu.l of AmpliTaq DNA polymerase of 5000 U/ml was added to each tube.

The PCR reaction was run using the program: 30 cycles -94oC. for 1 min; 55oC. for 2 min: 72oC. for 2 min. The amplified 750 bp band was separated by electrophoresis in 1.5% agarose gel and the DNA product isolated from the gel using Sephaglas Bandprep Kit. The purified DNA sample was dissolved in 20 .mu.l of TE buffer and stored at -20oC.

Restriction Digestion--4 .mu.l of the purified scFv DNA sample from the previous step was combined with the 5 .mu.l of 10xSfiI buffer and 5.mu.l of the SfiI restriction enzyme (Pharmacia, Sweden). Total volume was adjusted to 50 .mu.l with sterile distilled water and the mixture, overlayed with 50 .mu.l of mineral oil, was incubated overnight at 50oC. A NotI restriction digest mix was prepared by mixing 2.5 .mu.l of 5M NaCl, 5 .mu.l of 10xNotI buffer, 7.5 .mu.l of NotI restriction enzyme and 35 .mu.l of sterile distilled water. Total 50.mu.l of the mix were pipetted beneath the mineral oil layer of the SfiI digest and incubated overnight at 37oC. After the restriction digestion the sample was heated at 65oC. for 15 min. A MicroSpin Column loaded 1 with the Sephacryl S-400 HR resin (Pharmacia, Sweden) was equilibrated with the diluted ligation buffer (40 .mu.l of the ligation buffer and 160 .mu.l of sterile distilled water). The entire digested PCR product (excluding mineral oil) was applied to the MicroSpin Column and centrifuged at 800xg for 20 sec at 1.5 ml microcentrifuge tube. The effluent containing the purified scFv DNA was collected.

Ligation of the scFv gene into the pCANTAB 5E expression vector--25 .mu.l of the scFv gene product was combined with 2.mu.l of the 50 ng/.mu.l solution of the pre-digested pCANTAB SE expression vector DNA (Pharmacia, Sweden), 7 .mu.l of ligation buffer and 3 .mu.l of T4 DNA ligase (Gibco URL, USA). The mixture was incubated overnight at 16oC. in a 1.5 ml microcentrifuge tube.

Transformation--200 .mu.l of electroporation-competent E. coli TG1 cells (prepared as described in Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, USA) were transformed by 15 .mu.l of the ligated phagemid-antibody scFv DNA using a Bio Rad Gene Pulser apparatus with the following settings: 25 .mu.F, 2.5 kV at 200 ohms. The DNA preparation was desalted by drop-dialysis prior to the electroporation. Transformed cells were diluted with 800 .mu.l of fresh SOC medium and incubated for 1 hour at 30oC. with shaking at 150 rpm. After the incubation, cells were plated onto SOB agar plates containing 100 .mu.l of ampicillin and grown overnight at 30oC.

Rescue of the phagemid library from the plates--The plates were flooded with 5 ml of 2xYT medium (Sambrook, et al, op. cit.) and the colonies were resuspended by scraping with a sterile glass spreader, transferred to sterile 50 ml polypropylene tubes and diluted with 2xYT medium containing 100 .mu.g/ml of ampicillin and 2M of glucose until an A600 of 0.2-0.4 was reached. The diluted cells were grown at 37oC. with shaking at 200 rpm until an A600 of 0.7 was achieved. Phage rescue was performed by infection of the cell suspension with 2.5x109 pfu per ml of the M13KO7 phage (Pharmacia, Sweden) and incubation for 30 min at 37oC. with shaking at 100 rpm, followed by a 30 min incubation with shaking at 200 rpm. The cells were pelleted by spinning in a clinical centrifuge (Sorvall GLC-4) at full speed for 10 min. The supernatant was discarded, whereas the pellet was resuspended in 1 ml of 2xYT medium containing 100 .mu.g/ml of ampicillin and 50 .mu.g/ml of kanamycin and transferred to sterile 17x100 mm culture tubes (Falcon) filled with 4 ml of the medium used in pellet resuspension. After overnight incubation at 30oC. with shaking at 200 rpm, the cells were pelleted at full speed in a clinical centrifuge (Sorvall GLC-4) for 15 min and the supernatant containing the recombinant antibody phage was collected, filtered by passage through a 45 .mu.m (Millipore) filter and stored in the sterile 17x100 mm culture tubes (Falcon) at 4oC.

Panning to select for antigen-positive recombinant phage antibodies--Four rounds of panning were performed in 96-well microtiter plates (Costar, USA) coated as described in Part I with 10 .mu.g/ml of the BSA-heptapeptide conjugate. The phage supernatant was diluted two fold with PBS containing 1% of nonfat dry milk and applied by aliquotes of 200 .mu.l to each well of the microtiter plates. After overnight incubation at 4oC., the plates were washed 10 times with PBS containing 0.2% of Tween 20 and 10 times with PBS. To elute the bound recombinant phage, 200 .mu.l of log-phase TG1E. coli cell suspension were added to each well and incubated with intermittent gentle shaking for 30 min at 37oC. After the incubation, contents of each well was collected and pooled together. Several aliquotes of 200 .mu.l were taken from the combined pool, plated onto SOBAG plates (9) and incubated overnight at 30oC. The microtiter plates coated with 1 g/ml and 0.1 .mu.g/ml of the conjugate were employed for the fifth and sixth rounds of panning, respectively. The plates coated with 10 .mu.g/ml of BSA were used as a negative control. In the second part of the panning procedure, two rounds of panning were performed on the microtiter plates coated with 1 .mu.g/ml of the mutant p53 protein. Bacteriophage plaque counting assay was accomplished as in (Sambrook, et al, op. cit.).

Microtiter Plate Rescue of Enriched Phage Clones--100x.mu.l of 2YT medium containing 100 .mu.g/ml of ampicillin and 2% of glucose to each well on a sterile 96-well microtiter plate. Individual colonies were transferred to separate wells using sterile toothpicks and incubated overnight at 30oC. with gentle shaking (less than 100 rpm). 20 .mu.l of saturated culture from each well were transferred to a corresponding well in the second microtiter plate. Each well of this plate was pre-filled with 180 .mu.l of 2xYT medium containing 100 .mu.g/ml of ampicillin, 2% of glucose and 108 pfu of M13 KO7 phage. The second microtiter plate was incubated for 2 hours at 37oC. with shaking at 100 rpm. The contents of each well were transferred to individual 1.5 ml microcentrifuge tubes and pelleted at 1000xg for 10 min. Supernatants were discarded and pellets were resuspended in 200 .mu.l of 2xYT medium containing 100 .mu.g/ml of ampicillin and 50 .mu.l of kanamycin. The tubes were incubated overnight at 30oC. with shaking at 100 rpm. After the incubation, the cells were pelleted as described above and supernatants were collected and transferred to the sterile microcentrifuge tubes and stored at 40oC.

PEG Precipitation Of The Phage Antibody Supernatant--1 ml aliquotes of the phage antibody supernatant were mixed each with 200 .mu.l of PEG-NaCl solution, incubated on ice for 1 hour and spun in an Eppendorf microcentrifuge for 30 min at 40oC. The supernatants were carefully aspirated and discarded. The pellets were resuspended with 10 .mu.l of sterile TE buffer and stored at 40oC.

Infection of E. coli HB2151 Cells--E. coli HB2151 cells were grown to logarithmic phase in 5 ml of 2xYT medium. 200 .mu.l of log-phase cells were infected with 2 .mu.l of the precipitated phage antibodies and incubated with gentle shaking for 30 min at 37oC. 20 .mu.l aliquotes of the infected culture were plated onto SOBAG-N plates and grown overnight at 30oC.

Production of Soluble Antibodies--Several fresh colonies were selected from SOBAG-N plates. Each colony was transferred to 5 ml of SB-AG medium and incubated overnight at 30oC. with shaking at 200 rpm. The overnight culture was diluted to 50 ml with SB-AG medium and incubated for 1 hour at 30oC. with shaking at 200 rpm. The cells were pelleted by centrifugation at 1500xg for 15 min at room temperature in a Sorvall GLC-4 centrifuge, resuspended in 50 ml of SB-AI medium and incubated overnight with shaking at 200 rpm in 500 ml flasks. Each overnight culture was split into two equal aliquotes and centrifuged at 1500xg for 30 min at room temperature. The supernatants were collected, filtered through a 0.45 .mu.m filter and stored at 4oC.

To prepare the periplasmic extract, one of the cell culture pellets was resuspended in 0.5 ml of PBS containing 1 mM of EDTA and incubated on ice for 30 min. The contents was transferred into a 1.5 ml microcentrifuge tubes and centrifuged at the highest speed in a microcentrifuge for 30 min at 4oC. The supernatant was carefully transferred to a clean tube and stored at -20oC.

To prepare the whole cell extract the second pellet obtained from the overnight culture was resuspended in 0.5 ml of PBS and boiled for 5 min. The cell debris was pelleted as described above, the supernatant was transferred to a clean tube and stored at -20oC.

The supernatant, periplasmic and whole cell extract fractions were analyzed for the presence of soluble antibodies in ELISA and Western blot assays.

10. Detection of Soluble Antibodies In Supernatant, Periplasmic Extract, and Whole Cell Extract--The detection was performed with the anti-E tag monoclonal antibody (Pharmacia, Sweden) specific to the peptide E tag located at the C-terminal of single-chain antibody fragment expressed using the pCANTAB 5E vector. Electrophoresis and protein transfer were accomplished essentially as described in (Sambrook, et al, op. cit.). The ELISA and Western blot assay were carried out according to the anti-E tag antibody vendor instructions. The protein band visualization was performed by enhanced chemiluminescence method. The antigen-coated microtiter plates for the ELISA assay were prepared as described in the Part One.

DNA sequencing--The DNA sequence encoding the scFv ME1 antibody derived from the spleen of hyperimunized mouse was determined by using an Applied Biosystems model 377 automated DNA sequencing system at Tel Aviv University Life Sciences Faculty facilities.

Double-stranded DNA templates for the sequencing were prepared with the help of the Quiagen DNA purification kit according to manufacturer's protocol. Single-stranded DNA templates were prepared from the phage particles carrying recombinat single-chain antibodies by chloroform tecqnique as described in Sambrook, et al.

IV Expression of scFv ME1--the Single-chain Antibody Specific to the Common Epitope of Mutant p53 Protein--in Eucaryotic Cells

Subcloning of the scFv ME1 gene fragment into the pIRES-EGFP expression vector--The restriction digestion of the pIRES-EGFP was performed by incubation of the 1 .mu.g of the vector DNA with 1 .mu.l of 10 units/.mu.l solution of EcoR1 restriction enzyme (MBI Fermentas, Lithuania) in EcoR1 buffer at 37oC. overnight. The digested DNA was precipitated in high-salt as in (10) and de-phosphorylated by incubation with 5 .mu.l of 1000 units/ml solution of the calf intestine alkaline phosphatase (Boehringer, Germany). The digested and de-phosphorylated DNA was purified with the help of High Pure PCR Product Purification kit (Boehringer, Germany) according to the manufacturer's instructions and diluted in 100 .mu.l of sterile distilled water.

The scFv ME1 DNA fragment was prepared by PCR amplification using the pCANTAB5E-scFvME1 construct as a template. The reaction mix consisting of 10 .mu.l of Taq DNA polymerase buffer, 2 .mu.l of 10 mM dNTP solution, 8 .mu.l of 25 mM MgCl2 solution, 2 .mu.l of 1 mM solution of the forward primer GCGAATTCATGGCCCAGGTCAA, SEQ ID NO: 6, 2 .mu.l of 1 mM solution of the reverse primer GGAATTCAGTCTATGCGGCACG, SEQ ID NO: 7, and 10 ng of the template DNA was diluted with sterile distilled water to total volume of 100 .mu.l in 0.5 ml tube. The tube with reaction mixture was placed into PTC-200 thermocycler (MJ Research, USA), heated for 5 min at 95oC. and 1 .mu.l of 5000 U/ml solution of Taq DNA polymerase (Fermentas, Lithuania) was added. The PCR reaction was run with a program as follows: 30 cycles-94oC. for 45 sec; 55oC. for 1 min; 72oC. for 30 sec. The PCR product was purified with the help of High Pure PCR Product Purification kit (Boehringer, Germany) and 500 ng of its DNA was subjected to the restriction digestion with 1 .mu.l of 10 units/.mu.l solution of EcoR1 restriction endonuclease (MBI Fermentas, Lithuania) in EcoR1 buffer at 37oC. overnight. The digested DNA was purified as above and diluted in 50 .mu.l of sterile distilled water.

The ligation reaction was set up by mixing 1 .mu.l of the EcoRI--digested and de-phosphorylated pIRES-EGFP DNA solution, 6 .mu.l of the EcoRI--digested scFv ME1 DNA solution, 2 .mu.l of T4 DNA ligase 5xbuffer, 1 .mu.l of T4 DNA ligase (BRL, USA) and incubated overnight at 16oC. 3 .mu.l of the ligation mixture were taken for transformation of competent E. coli cells by electroporation as described in part II. Transformed cells were plated onto LB agar plates (Sambrook, et al, op. cit.) containing 100 .mu.l of ampicillin and grown overnight at 37oC. Colonies were re-plated and their plasmid DNA was isolated using High Pure Plasmid DNA Purification kit (Boehringer, Germany). 10 .mu.l of each plasmid DNA preparation was subjected to the restriction digestion by incubation with 0.1 .mu.l of a solution of BamHI restriction endonuclease (Fermentas, Lithuania) at 37oC. overnight. Selected colonies were grown overnight in 10 ml of LB medium at 37oC. with shaking at 200 rpm overnight. The pIRES-EGFP-scFvME1 plasmid DNA was isolated with the help of the Qiagen Plasmid Purification kit (Quiagen, USA).

Expression of the scFv ME1 in eucaryotic cells--293 cell line (transformed primary embryonal human kidney cells) was grown in Dulbecco's Modified Eagle's Medium (DMEM) with high glucose (4.5 g/l) (Biological Industries (Israel)) supplemented with 5 mM L-glutamine (Biological Industries, Israel), 100 U/ml penicillin and streptomycin solution (Biological Industries, Israel ) and 15% heat inactivated (56oC., 30 min ) fetal calf-serum ( Biological Industries, Israel). Cells were grown at 10% CO2 at 37oC. in a six-well or 35 mm tissue culture plate (Costar, USA) to 50% or 70% of confluency before transfection. The transfection procedure was accomplished with the help of LipofectAMINE reagent (Gibco BRL, USA) in the following order:

1) 1.5 .mu.g of the transfecting DNA was diluted into 100 .mu.l of the OPTI-MEM I reduced Serum Medium (Gibco BRL, USA) in 12x75 mm sterile tubes (Falcon, USA);

2) 7 .mu.l of LipofectAMINE reagent was diluted into 100 .mu.l of OPTI-MEM medium in 12x75 mm sterile tubes;

3) The two solutions were combined and, mixed gently and incubated for 45 min at room temperature.

4) Following incubation, 0.8 ml of OPTI-MEM medum were added to each tube, mixed gently and overlayed onto the recipient cells pre-rinsed with 2 ml of OPTI-MEM medium.

5) After 5 hours of incubation with the transfection mixture, 1 ml of growth medium containing 30% of fetal calf-serum was added to the cells.

6) The medum was replaced with fresh, complete growth medium after 24 hours from the start of transfection.

At 48 hours after transfection cells were rinsed once with sterile PBS and EGFP fluorescence was detected by microscopy.

After the accomplishment of fluorescence detection, cells were harvested from tissue culure plates with the help of a "rubber policeman", resuspended in 2 ml of sterile PBS containing 0.5% of Nonidet P-40 (Sigma, USA) and incubated for 5 min on ice. The suspension was centrifuged for 5 min at 1000 rpm in a desktop centrifuge at 4oC., the supernatant containing cytosplasmic lisate was collected and frozen at 20oC. The electrophoresis and Western blot assay were performed as described in Section III.

The transfection efficiency assay was performed employing the pUT535 -.beta.gal expression vector (Cayla, France).

V. Cloning, Construction and Phage Display of scFv from the Spleen of Hyperimmunized Mice

(a) Immunization Protocol

Five female BALB/c mice were immunized with the mutant p53 epitope peptide conjugated to BSA and boosted with the conjugate. To follow the course of the immunization, mice were bled and policlonal sera were prepared according to Harlow E. Lane D. (1988), op.cit. Titers of the antibodies specific to the conjugated and non-conjugated heptapeptide were measured in ELISA assay as described in Section I above.

Claim 1 of 6 Claims

What is claimed is:

1. A DNA molecule comprising SEQ. ID. No: 1.



____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]