Title:  Polymerase chain reaction assays for monitoring antiviral therapy and making therapeutic decisions in the treatment of acquired immunodeficiency syndrome

United States Patent:  RE38,352

Issued:  December 16, 2003

Inventors:  Kozal; Michael J. (Menlo Park, CA); Merigan; Thomas C. (Portola Valley, CA)

Assignee:  Leland Stanford Junior University (Palo Alto, CA)

Appl. No.:  236326

Filed:  September 5, 2002

Abstract

The present invention relates to methods of monitoring, via polymerase chain reaction, the clinical progression of human immunodeficiency virus infection and its response to antiretroviral therapy. According to the invention, polymerase chain reaction assays may be used to predict immunological decline and to identify, at an early stage, patients whose infection has become resistant to a particular antiretroviral drug regimen.

SUMMARY OF THE INVENTION

The present invention relates to methods of monitoring, via polymerase chain reaction (PCR), the clinical progression of human immunodeficiency virus (HIV) infection and its response to antiviral therapy. It is based, in part, on the discovery that plasma HIV RNA copy number, as measured using PCR, may be used as a sensitive marker of the circulating HIV viral load to assess the therapeutic effect of antiretroviral compounds. In working examples described herein, an increase in plasma HIV RNA copy number was found to correlate with disease progression, and successful antiretroviral therapy was found to correlate with a decline in plasma HIV RNA copy number.

The invention is also based, in part, on the discovery that genetic changes in HIV which confer resistance to antiretroviral therapy may be rapidly determined directly from patient peripheral blood mononuclear cells (PBMC) and/or plasma HIV RNA using a "nested" PCR procedure. In working examples disclosed herein, a mutation at codon 215 of HIV reverse transcriptase (RT) was found to occur in AZT-treated patients which correlated with refractoriness to AZT treatment. The mutation was found in plasma HIV RNA one to eight months before it was detectable in PBMC. The development of the codon 215 mutation in HIV RT was found to be a harbinger of immunological decline, which occurred between six and twelve months after the mutation was detectable in plasma HIV RNA.

In particular embodiments of the invention, PCR assay may be used to monitor the clinical progression of HIV infection in patients receiving antiretroviral therapy. An increase in plasma HIV copy number detected by such an assay would correlate with refractoriness to treatment. If a patient being treated with an antiretroviral therapeutic agent exhibits an increase in plasma HIV RNA copy number, a physician should consider altering the patients treatment regimen. It should be noted that the present invention offers the advantage of being more sensitive in measuring HIV virus than standard methods which measure plasma p24 antigen or infectious virus detectable by culture techniques.

In further embodiments of the invention, PCR assay may be used to detect mutations at codon 215 of HIV RT which correlate with resistance to antiretroviral therapy and which precede immunologic decline by 6-12 months. Once mutation at codon 215 has been detected in a patient undergoing antiretroviral therapy, an alteration in the therapeutic regimen must be considered. The speed at which a modified regimen should be instituted may depend on whether the mutation is present in plasma HIV RNA or PBMC. If the mutation is present in PBMC, a rapid alteration in therapy may be warranted.

In further embodiments of the invention, PCR assay may be used to detect and monitor the absolute concentrations and relative proportions of virus which mutations at codon 74 of HIV RT, a mutation which correlates with resistance to therapy with didanosine (ddI). When mutation at codon 74 has been detected in patient undergoing monotherapy with ddI, an alteration in the therapeutic regimen must be considered. Such alteration may include combination therapy, e.g. ddI and AZT, or combination therapy with another antiviral agent.

In patients suffering from HIV infection, opportunistic infections arising as a result of a compromised immune system can be rapidly fatal. It is therefore extremely important to strive to avoid deterioration of the immune system in these patients. Because the present invention enables the early prediction of immunological decline, it allows alteration of a patient's therapeutic regimen so as to avoid opportunistic infections, and therefore may be used to promote survival and improve the quality of life of HIV-infected patients.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to methods of monitoring, via PCR, the clinical progression of HIV infection in patients receiving antiretroviral therapy. For purposes of clarity and not by way of limitation, the detailed description of the invention is divided into the following subsections:

(i) PCR assay of plasma HIV RNA;

(ii) PCR assay of peripheral blood mononuclear cells;

(iii) PCR assay for mutation at codon 215 of HIV reverse transcriptase;

(iv) PCR assay for mutation at codon 74 of HIV reverse transcriptase; and

(v) utility of the invention.

It should be noted that heparin appears to have an inhibitory effect on gene amplification via PCR. It is therefore desirable to avoid using heparin as an anticoagulant of patient blood samples. If heparin has been used in a sample, the sample may be purified of heparin, for example, by collecting virus by ultracentrifugation.

5.1 PCR ASSAY OF PLASMA HIV RNA

According to the invention, it is desirable to avoid degradation of RNA in plasma samples prior to measurement of HIV RNA copy number. Therefore, in preferred embodiments of the invention, guanidinium is added to plasma or serum samples prior to storage at a concentration of about 2.5M and samples are kept frozen at -70^oC., with no samples stored for longer than about 3 months. Serum may be used interchangeably with plasma according to the invention.

RNA may be extracted from plasma using standard techniques, such as those set forth in Chomczynski and Sacchi, 1987, Ann. Biochem. 162:156-159. For example, 200 .mu.l of clarified plasma to which 200 .mu.l of 5M guanidinium thiocyanate had previously been added may be extracted with phenol/chloroform and precipitated with isopropanol. The resulting pellet may then be washed in 75 percent ethanol, dried, and brought up into solution in diethylpyrocarbonate-treated glass distilled water.

From plasma RNA, HIV RNA may be transcribed to cDNA using a suitable reverse transcriptase (for example, Moloney murine leukemia virus reverse transcriptase) using standard techniques, such as for example, those set forth in Kawasaki, 1990, in "PCR Protocols: A Guide to Methods and Applications," Innis et al., eds. Academic Press, Berkeley, Calif. pp. 21-27. Any suitable primer for amplification of HIV genomic RNA sequences may be used, include, but not limited to, the oligomers SK38, SK39, and SK19 (FIG. 7) described in Kellog et al., 1990, in "PCR Protocols: A Guide To Methods and Applications," Innis et al., eds., Academic Press, Berkeley, Calif. pp. 337-347. In a preferred embodiment of the invention, HIV cDNA may be amplified as follows: to a 100 .mu.l reaction mixture, cDNA prepared as described supra may be added, together with 50 pmol of primers SK38 and SK39, 10 mM of each dNTP, 10 mM Tris (pH 8.3), 2.5 mM MgCl₂, 50 mM KCl, and 2.5 U of recombiTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, Conn.). The mixture may then be overlaid with 50 gl of mineral oil, and tubes containing the reaction may be placed in a DNA thermal cycler (e.g. Perkin-Elmer Cetus) for about 30 cycles of amplification with the following program: 95^oC./30 seconds, 55^oC./30 seconds, and 72^oC./60 seconds for denaturation, annealing, and extension, respectively. Negative and positive controls which include both high and low copy number HIV RNA and DNA may be added at each step.

The number of PCR cycles may be adjusted to amplify the DNA segments to detectable levels while retaining linearity. Usually the number of PCR cycles will be less than 40, often less than 35, and typically only about 30. If the amplified DNA is not readily detectable at 30 cycles, the PCR may be continued for a few cycles more, e.g. to 33 or 35, and reprobed.

The copy number of HIV RNA may then be measured by methods known to the skilled artisan. For example, the number of copies of HIV RNA in a patient sample may be quantiated by hybridizing the product of the above PCR with a detectably labeled probe that is complementary to HIV sequence. The amount of signal generated by probe hybridized to PCR product may then be compared to the amount of signal generated by probe hybridized to a known copy number of HIV. Probe may be detectably labeled by an enzyme, a radioisotope, a fluorescent compound, a chromogenic compound, or any other detectably labeled compound.

In a preferred, nonlimiting embodiment of the invention, at least one of the PCR primers may be biotinylated, probe may be labeled with horseradish peroxidase (HRP), and copy number may be evaluated by an enzyme-linked affinity assay as follows. 96-well microplates (Maxisorp; Nunc, Naperville, Ill.) may be coated with 100 .mu.l of a 0.1 mg/ml solution of avidin (Sigma Chemical Co., St. Louis, Mo.) in 50 mM Na₂ CO₃ (pH 9.6) overnight at room temperature. Wells may then be washed twice with PBS, and then filled with 300 .mu.l of a blocking solution containing 5X Denhardt's solution, 1% gelatin (Sigma), 250 .mu.l/ml sheared herring sperm DNA (Promega Biotec, Madison, Wis.) at least overnight at 4^oC. Immediately before use, the blocking solution may be aspirated from each well and 5 .mu.l of PCR product prepared as described supra (using at least one biotinylated primer) may be added to each well together with 65 .mu.l of a hybridization solution containing 5x saline sodium phosphate EDTA, 5x Denhardt's solution; and 1 pmol of HRP-labeled SK19 HIV gag-specific probe. Because HIV primer was biotinylated, HIV amplified sequences should selectively adhere to the avidin-coated wells, so that a capture and hybridization reaction may be carried out for 1 hour at 42^oC. Each well may then be washed about 20 times with PBS containing 0.05% Tween-20, for example, using a Biomek.TM. 1000 Automated Workstation (Beckman Instruments, Inc., Palo Alto, Calif.). The HRP substrate O-phenylenediamine (Sigma) may then be prepared at 0.6 mg/ml in 0.1M citrate buffer (pH 5.5) containing 0.03% hydrogen peroxide, and 150 .mu.l of this solution may be added to each well. After about 10 minutes the reaction may be stopped with 1N H₂ SO₄ and the optical density of each well measured at 490 nm, for example by the Biomek 1000. A lower level of positivity had been defined as an absorbance of 0.135. This cutoff value was calculated from the mean absorbance obtained from a group of seronegative samples plus three standard deviations. Copy number from subject samples may be determined from the absorbances obtained from a dilution series of an RNA gag gene construct of known copy number (Holodniy et al., 1991, J. Infect. Dis. 163:862-866).

In an alternate preferred, specific embodiment for detection of codon 215 mutations, RNA collected from plasma may be reverse-transcribed by using 500 ng of primer NEI (5'-TCATTGACAGTCCAGCT-3')(SEQ ID NO:7) and 200 units of MuLV RT (Bethesda Research Labs) in 10 .mu.l of amplification buffer (25 mM kCL, 50 mM Tris HCl pH 8.3, 0.1 mg/ml bovine serum albumin, 1.45 mM each of dATP, dGTP, dCTP and dTTP, 1.5 mM MgCl₂, and 2.5 U of RNasin (Promega)) for 10 min. at room temperature, then 30 minutes at 42^oC. followed by heat inactivation at 95^oC. for 5 min. This cDNA may then be amplified by PCR using 250 ng of primer A (5'-TTCCCATTAGTCCTATT-3')(SEQ ID NO: 8) in a reaction mixture (100 .mu.l) containing the same buffer as above with 0.25 mM of each dNTP and 2.5 U of Amplitaq DNA polymerase, using about 30 cycles of 94^oC. for 1 min., 45^oC. for 1 min, and 72^oC. for 2 min, to generate a 768 bp region of the HIV pol gene.

5.2 PCR ASSAY OF PERIPHERAL BLOOD MONOMUCLEAR CELLS

Peripheral blood mononuclear cells (PBMCS) may be used fresh or following cryopreservation (e.g. at -190^oC.). DNA may be prepared from PBMCs using standard techniques for use in detection of HIV proviral DNA.

Any suitable HIV primer oligonucleotide(s) may be used in PCR to detect HIV provirus.

In a preferred, nonlimiting embodiment of the invention, cryopreserved (-190^oC.) PBMC may be treated with a lysis buffer (for example, 0.45 percent Tween-20, 10 mM Tris HCl pH 8.0, 2.5 mM MgCl₂, 50 mM KCl, and 0.1 mg/ml proteinase K) for about two hours at 56^oC. and then heat inactivated at 95^oC. for 10 minutes. Approximately 1 .mu.g of DNA (20 .mu.l of the PBMC lysate) may be used in the initial PCR amplification with primers A (5'-TTCCCATTAGTCCTATT-3')(SEQ ID NO:8) and NE1 (5'-TCATTGACAGTCCAGCT-3')(SEQ ID NO:7) with reaction conditions as set forth in Larder et al., 1991, AIDS 5:137-144 to generate a 768 bp region of the HIV pol gene.

5.3 PCR ASSAY FOR MUTATION AT CODON 215 OF HIV REVERSE TRANSCRIPTASE

To analyze the changes in codon 215 of the HIV pol gene, a "double" or "nested" PCR procedure was performed using the primers, reagents, and reaction conditions described by Larder et al., 1991, AIDS 5:137-144. Five .mu.l of the 768 bp product generated by PCR with primers A (5'-TTCCCATTAGTCCTATT-3')(SEQ ID NO:8) and NE1 (5'-TCATTGACAGTCCAGCT-3')(SEQ ID NO:7) and either plasma HIV RNA or PBMC DNA may be used in a second series of nested PCR amplifications using primers that detect wild-type sequence or sequence mutated at codon 215. In preferred, non-limiting embodiments of the invention, the following primers may be used: to detect wild-type sequence primers B (5'-GGATGGAAAGGATCACC-3')(SEQ ID NO:9) and 3W (3'-TGGTGTGGTCTGTTTTTTGTA-5') (SEQ ID NO:10) and to detect mutants at codon 215, primers B (supra) and 3M (3'-AAGTGTGGTCTGTTTTTTGTA-5')(SEQ ID NO:11). PCR may then be performed as follows. About 1 .mu.l of template may be used per PCR reaction in 100 .mu.l containing 25 mM KCl, 50 mM Tris HCl pH 8.3, 0.1 mg/ml bovine serum albumin (BSA), 0.2 mM each of DATP, dGTP, dCTP and dTTP, 0.25 .mu.l of each oligonucleotide primer, and 1.5 mM MgCl₂. Reaction mixtures may be heated at 100^oC. for two minutes prior to addition of Taq DNA polymerase (2.5 U, Perkin-Elmer Cetus, Connecticut), overlaid with 100 .mu.l of light mineral oil, and subjected to 30 cycles consisting of a denaturation step (1 minute, 94^oC.), primer annealing (30 seconds, 45^oC.) and DNA synthesis (30 seconds, 72^oC.) using, for example, a Perkin Elmer Cetus DNA thermal cycler. Ten .mu.l of PCR product from each set of "nested" PCR reactions may then be analyzed to determine the presence and intensity of the products. For example, PCR reactions may be analyzed on a 3.0 percent agarose gel with ethidium bromide staining; a portion of a patient sample subjected to "nested" PCR using primers B and 3W may be run in a lane next to another portion of the same patient sample subjected to "nested" PCR using primers B and 3M. A 210 bp PCR product would be expected; if the patient sample contained HIV RT having the codon 215 mutation, the lane carrying primer B/3M PCR product should exhibit a band that is more intense than any corresponding band in the primer B/3W lane. If the patient sample contained only wild type HIV RT, the band in the primer B/3W lane should be more intense than any corresponding band in the primer B/3M lane. Alternatively, if the patient sample contained a mixture of wild type and mutant HIV RT, bands of similar intensities should be in both lanes. If a sample yielded product with wild-type and mutant primers, the second PCR step may be repeated with serial dilutions of the first round PCR (at dilutions of 1:20, 1:400, and 1:8000); if a mixture of wild type and mutant is still present after serial dilutions, the sample is considered a mixture of wild-type and mutant sequences at the codon of interest.

5.4 PCR ASSAY FOR MUTATION OF CODON 74 OF HIV REVERSE TRANSCRIPTASE

To ascertain the genetic sequence at codon 74, 5 .mu.l of product from the first PCR (using primers A and NE1) may be amplified in a second PCR with primers X2 (5'-AACAATGGCCATTGACAGA-3')(SEQ ID NO:4) and 74WT (wildtype) or X2 and 74M (mutant). The second PCR is a variation of the method described supra using primer X2 instead of primer A. The PCR mixture contained 25 mM Tris HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, 2.5 U Amplitaq DNA polymerase, 250 ng of primer X2 and 250 ng of either primer 74WT or 74M. The reactions were amplified for 30 cycles at 94^oC. for 60 sec, 45^oC. for 30 sec, and 70^oC. for 1 min to generate a 178 bp product.

PCR products were analyzed on 3% agarose gels and visualized by ethidium bromide staining. Samples which yielded product (210-bp for codon 215, 178-bp for codon 74) with the wildtype primers were considered to have a wildtype sequence. Samples which yielded product with the mutant primers were considered to have a mutation at the codon of interest. The product of the first PCR was diluted 1:20 (0.25 .mu.l) and the second PCR was repeated whenever product was initially detected with both wildtype and mutant primers. If product was still detected with both wildtype and mutant primers following dilution, samples were considered to have a mixture of mutant and wildtype forms. For purposes of analysis, HIV-1 strains with either a mutant sequence or a mixture of sequences at a specific codon were considered mutant.

DNA sequencing: A nested PCR assay was also used to obtain DNA segments for sequencing. The first round PCR primers consisted of A' and NE1' [16] which resulted in the amplification of an .apprxeq.800 bp fragment of the pol gene. The second round PCR primers were pol1 (SEQ ID NO:12) {5'TGTAAAACGACGGCCAGTGTTAAACAATGGCCATTGATTGACAG3', bp 2609-2630} and pol2 (SEQ ID NO:13) {5'GCAGGAAACAGCTATGACCACAGTGGAGCTGTC3'(SEQ ID NO:14), bp 3287-3309} which contained the M13 forward and reverse primer binding site (underlined) at their 5' ends. This PCR amplified an .apprxeq.700 bp gene fragment encompassing codons 28-247 of HIV-1 pol. Second-round PCR products were run on agarose gels and the amplified fragment was excised and purified by centrifugation through Spin-ex columns (Costar). Following precipitation, DNA was sequenced directly using dye-labeled M13 forward and reverse primers on a model 370A DNA Sequencer (Applied Biosystems, Inc., Foster City, Calif.). All sequences were proofread manually.

5.5 UTILITY OF THE INVENTION

The present invention relates to methods of monitoring, via PCR, the clinical progression of HIV infection in patients receiving antiretroviral therapy. Techniques described in Sections 5.1 through 5.4 supra, may be used as set forth below.

In one particular embodiment, the present invention provides for a method of evaluating the effectiveness of antiretroviral therapy of a patient comprising (i)collecting a plasma sample from an HIV-infected patient who is being treated with an antiretroviral agent; (ii) amplifying the HIV-encoding nucleic acid in the plasma sample using HIV primers in about 30 to 40 cycles of PCR; and (iii) testing for the presence of HIV sequence in the product of the PCR; in which the absence of detectable HIV sequence correlates positively with the conclusion that the antiretroviral agent is therapeutically effective and the presence of detectable HIV sequence correlates positively with the conclusion that the antiretroviral agent is therapeutically ineffective. In further, related, embodiments, the presence of detectable HIV sequence correlates positively with an absolute CD4 count of less than 200 cells/mm³, and the absence of detectable HIV sequence correlates positively with a CD4 count greater than 200 cells/mm³. The phrase "correlates positively," as used herein, indicates that a particular result renders a particular conclusion more likely than other conclusions.

In another particular embodiment, the present invention provides for a method of evaluating the effectiveness of antiretroviral therapy of a patient comprising (i) collecting a plasma sample from an HIV-infected patient who is being treated with an antiretroviral agent; (ii) amplifying the HIV-encoding nucleic acid in the plasma sample using HIV primers in about 30 to 40 cycles of PCR; and (iii) measuring the HIV RNA copy number using the product of the PCR, in which an HIV RNA copy number greater than about 500 correlates positively with the conclusion that the antiretroviral agent is therapeutically ineffective, and an HIV RNA copy number less than about 200 correlates positively with the conclusion that the antiretroviral agent is therapeutically effective.

In a further embodiment, the present invention provides for a method of evaluating the effectiveness of antiretroviral therapy of a patient comprising (i) collecting one pre-treatment plasma sample from an HIV-infected patient who is about to be treated with an antiretroviral agent; (ii) collecting a post-treatment plasma sample from the HIV-infected patient after the patient has been treated with the antiretroviral agent; (iii) amplifying the HIV-encoding nucleic acid in the pre-treatment and post-treatment plasma samples using HIV primers in a number of cycles of PCR sufficient to linearly amplify the HIV-encoding nucleic acid to detectable levels, preferably in about 30 to 40 cycles of PCR; (iv) measuring the HIV RNA copy number using the products of the PCRs of step (iii); and (v) comparing the HIV RNA copy number in pre-treatment and post-treatment plasma samples, in which a ratio of HIV RNA copy number in pre-treatment and post-treatment plasma samples of greater than about 4 to 1 or even 10 to 1 correlates positively with the conclusion that the antiretroviral agent is therapeutically effective.

In additional embodiments of the invention, PCR assay may be used to detect mutations at codon 215 of HIV RT which correlate with resistance to antiretroviral therapy and which precede immunologic decline by 6-12 months. Accordingly, the present invention provides for a method of evaluating the effectiveness of antiretroviral therapy of a patient comprising (i) collecting a plasma sample from an HIV-infected patient who is being treated with an antiretroviral agent; and (ii) determining (for example, using "nested" PCR) whether the plasma sample comprises nucleic acid encoding HIV RT having a mutation at codon 215, in which the presence of the mutation correlates positively with immunologic decline of the patient within a six to twelve month period. Under such circumstances, the HIV virus infecting the patient has become, via the mutation, resistant to the antiretroviral agent. It therefore maybe desirable after detecting the mutation, to either increase the dosage of antiretroviral agent, change to another antiretroviral agent, or add one or more additional antiretroviral agents to the patient's therapeutic regimen. For example, if the patient was being treated with zidovudine (AZT) when the mutation arose, the patient's therapeutic regimen may desirably be altered, within about a six to twelve month period of the mutation's occurrence, by either (i) changing to a different antiretroviral agent, such as dideoxyinosine (ddI) and stopping AZT treatment; or (ii) increasing the dosage of AZT; or (iii) adding another antiretroviral agent, such as ddi,to the patient's therapeutic regimen. The effectiveness of the modification in therapy may be evaluated, as set forth above, by monitoring the HIV RNA copy number. A decrease in HIV RNA copy number correlates positively with the effectiveness of a treatment regimen.

Because the mutation at the 215 codon appears first in plasma HIV RNA and later in PBMC proviral DNA, once the mutation is detected in proviral DNA, the treatment regimen is desirably modified with haste in order to avoid immune decline. Accordingly, the present invention provides for a method of evaluating the effectiveness of antiretroviral therapy of a patient comprising (i) collecting PBMC from an HIV-infected patient who is being treated with an antiretroviral agent; and (ii) determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codon 215, in which the presence of the mutation correlates positively with immunologic decline of the patient within a 4-11 month period (because, as discussed in Section 7, infra, a mutation in serum HIV RNA was found to precede the mutation in proviral DNA by 1-8 months). Once the mutation is detected in proviral DNA, immune decline becomes even more imminent, and alteration of the patient's therapeutic regimen is desirable.

When immune decline is heralded by the increase in HIV RNA copy number and/or the presence of the mutation at codon 215, in addition to altering the patient's antiretroviral therapy, it may also be desirable to treat the patient prophylactically for opportunistic infections, using antifungal, antibiotic, and/or antiparasitic medications.

Antiretroviral agent, as used herein, includes any known antiretroviral agent including, but not limited to, dideoxynucleosides. In preferred embodiments of the invention the antiretroviral agent is AZT. Resistance to certain antiretroviral agents, including AZT, is associated with the mutation at codon 215. Resistance to other antiretroviral agents, such as ddI, is associated with a mutation at codon 74. The present invention provides for analogous techniques in which the effectiveness of antiretroviral therapy is monitored by determining whether plasma HIV RNA or PBMC contain a mutation at codon 74 of HIV RT, in which a mutation at that locus augurs immunological decline and warrants a modification of antiretroviral therapy.

One preferred, non-limiting, specific embodiment of the invention is as follows: A method of evaluating the effectiveness of AZT therapy of a patient comprising (i) collecting a plasma sample from an HIV-infected patient who is being treated with AZT; (ii) amplifying the HIV-encoding RNA in the plasma sample by converting the RNA to cDNA and amplifying HIV sequences using HIV primers in a number of cycles of PCR sufficient to linearly amplify the HIV-encoding nucleic acid to detectable levels, preferably in about 30 to 40 cycles of PCR; and (iii) testing for the presence of HIV sequence in the product of the PCR, in which the absence of detectable HIV sequence correlates positively with the conclusion that AZT is herapeutically effective and the presence of detectable HIV sequence correlates positively with the conclusion that AZT is therapeutically ineffective. In most preferred embodiments, the HIV primers used comprise NE1 (supra), SK38 and/or SK39 (supra) or X2 and 74WT or 74M, and/or the presence of HIV sequence is detected using an enzyme-linked assay (e.g. a horseradish peroxidase based assay). Similar embodiments in which the HIV copy number is measured are also provided for.

Another preferred, non-limiting, specific embodiment of the invention is as follows: A method of evaluating the effectiveness of AZT therapy of a patient comprising (i) collecting a plasma sample from an HIV-infected patient who is being treated with AZT; (ii) amplifying the HIV-encoding RNA in the plasma sample by converting the RNA to cDNA and amplifying HIV sequences using HIV primers that result in a PCR product that comprises that portion of the RT gene that contains the 215 codon or the 74 codon (e.g. primers A and NE1, supra), or both 215 and 74; (iii) performing "nested" PCR using primers that result in PCR products that reflect the presence of 215 wild type (e.g. primers B and 3W, supra) or mutant codons (e.g. primers B and 3M, supra), or 74 wild type (e.g. primers X2 and 74WT) and mutant codons (e.g. primers X2 and 74M); and (iv) determining, via the products of "nested" PCR, the presence or absence of a mutation at codon 215 or 74 or both of the HIV RT, in which the presence of the mutation correlates positively with immunologic decline of the patient within a six to twelve month period. An analogous method may be used in which the patient sample is PBMC, and the presence of a mutation in proviral DNA is determined.

The presence of the codon 215 mutation indicates that the effectiveness of monotherapy with AZT is likely to decline either in the presence or the absence of the codon 74 mutation. Combination therapy with AZT or a switch to other drugs is generally indicated. Similarly, the presence of the codon 74 mutation indicates that monotherapy with didanosine is likely to decline in effectiveness, and combination therapy, e.g. with didanosine and AZT, or treatment with drugs other than didanosine is generally indicated.

The present invention also provides a kit for detection of mutations at codons 215 or 74 or both.

The kit comprises a first pair of PCR primers which bind outside the region of codon 215 or 74 and therefore may be used to amplify a DNA fragment containing 215 or 74 (e.g. primers A and NE1); and at least two pairs of second round primers which may be used to amplify selectively 215 wild type (e.g. B and 3W) and 215 mutant (e.g. B and 3M) sequences, or 74 wild type (e.g. X2 and 74WT) and 74 mutant (e.g. X2 and 74M) sequences. Optionally the kit may include all four pairs of second primers. Similar primers may be readily chosen by those skilled in the art; the first pair of primers need only amplify a conveniently-sized DNA fragment containing the codon of interest, and one member of the second pair of primers should bind to the codon of interest, preferably having its 3' terminus at the codon of interest in order to maximize the probability of a perfect match resulting in amplification. Optionally the kit may include instructions for interpretation indicting that the presence of the mutant form at the codon of interest correlates with reduced efficacy of a particular antiretroviral therapeutic agent: e.g. presence of the codon 215 mutant indicates reduced efficacy of monotherapy with AZT, and presence of the codon 74 mutant indicates reduced efficacy of monotherapy with ddI.

Claim 1 of 45 Claims

What is claimed is:

1. A method of evaluating the effectiveness of antiretroviral therapy of an HIV-infected patient comprising:

(i) collecting a plasma sample from an HIV-infected patient; and

(ii) determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at .[.codons.]. .Iadd.codon .Iaddend.215 .[.or 74, or codons 215 and 74.]. , in which the presence of the .[.mutations.]. .Iadd.mutation .Iaddend.correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the .[.mutations.]. .Iadd.mutation.Iaddend..

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.