Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 

Title:  Reporter gene based method for the screening of anti-tuberculosis drugs by using essential and regulatory genes of mycobacteria as drug target

United States Patent:  6,645,505

Issued:  November 11, 2003

Inventors:  Soni; Vishal (Chandigarh, IN); Khandrika; Lakshami Pathi (Chandigarh, IN); Agrawal; Pushpa (Chandigarh, IN)

Assignee:  Council of Scientific and Industrial Research (New Delhi, IN)

Appl. No.:  818236

Filed:  March 27, 2001

Abstract

The present invention relates to a method for making recombinant Saccharomyces cerevisiae. The method includes the steps of amplifying one or more whiB-like genes of Mycobacteria by polymerase chain reaction (PCR), cloning the amplified one or more whiB-like genes into a plasmid, transforming the clone into an E. coli using a first shuttle vector, amplifying the clone, introducing the amplified clone into a second shuttle vector, introducing said second shuttle vector into Saccharomyces cerevisiae.

SUMMARY OF THE INVENTION

The present invention relates to a drug screening method taking advantage of the yeast two-hybrid system, known in the literature. The invention also describes that the whiB genes are essential regulatory genes of Mycobacterium tuberculosis H37Rv and appear to be conserved amongst the pathogenic and slow growing mycobacteria. Thus the novelty of the method of the invention is to use the whiB genes which are regulatory genes of mycobacteria, whose functions have not been reported so far, as drug target by using the yeast Saccharomyces cerevisiae as a surrogate host.

DETAILED DESCRIPTION OF THE INVENTION

To accomplish the aforesaid and other objectives, it is essential to demonstrate that a functional target gene is essential for the survival of the Mycobacterium tuberculosis H37Rv. The sporulation gene homologue of Streptomyces coelicolor A3(2) was found to be present in Mycobacterium tuberculosis H37Rv. Since mycobacteria are not known to sporulate, it was assumed that these sporulation homologues would have yet unknown but important function. It has been assumed that the whiB genes may act, as a transcription activator and therefore would have regulatory function. It is further assumed that a regulatory gene, which controls sporulation, yet present in a non-sporulating organism, may indeed be an essential gene.

The drug screening method described in this invention takes advantage of the yeast two-hybrid system known in the literature. The invention also describes that the whiB genes are essential regulatory genes of Mycobacterium tuberculosis H37Rv and appear to be conserved amongst the pathogenic and slow growing mycobacteria. Thus the novelty of the invention is to use the whiB genes which are regulatory genes of mycobacteria, whose function have not been reported so far, as a drug target by using the yeast Saccharomyces cerevisiae as a surrogate host.

Mycobacterium tuberculosis H37Rv is a slow growing organism and is highly virulent. Thus, the use of live organism poses a severe health hazard. Therefore, it was essential to develop a screening system in a different host organism, which is nonpathogenic, fast growing and also to provide a method that is adaptable to High-Through-Put screening or any other automated screening systems.

Accordingly, the invention provides a reporter gene based method for the screening of anti-tuberculosis drugs comprising using whiB like genes (whiB1, whiB2 whiB3 whiB4) present in Mycobacterium tuberculosis H37Rv, Mycobacterium bovis BCG and Mycobactereium leprae having DNA and protein sequence as shown in sequence ID 1 to 4 as drug targets for the screening of anti-tuberculosis and anti-leprosis drugs.

The whiB3 gene of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG can be used for the screening of anti-tuberculosis drugs. The presence of functional whiB4 gene of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG is important for their normal growth. The whiB4 gene of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG code for a DNA binding protein. The drugs against whiB2 and the whiB4 genes of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG will be particularly useful where drug resistance has developed against the whiB1 and whiB3 genes or where the anti-whiB1 and anti-whiB3 drugs are allergic or toxic. The source of whiB like genes can be Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis and Mycobacterium xenopi and related organisms.

Further, the present invention provides for a reporter gene based method for the screening of anti-tuberculosis drugs by using essential and regulatory genes of mycobacteria as a drug target and comprises the following steps:

(a) amplifying the whiB genes of Mycobacterium tuberculosis H37Rv by polymerase chain reaction (PCR);

(b) cloning the products obtained in step (a) into plasmid vectors such as pUC19 or pBluescript SK+ or SK- and transforming into E. coli;

(c) amplifying whiB genes of Mycobacterium bovis BCG by using the oligonucleotide primers of Mycobacterium tuberculosis H37Rv;

(d) cloning the product obtained in step (c) into a plasmid vector pUC19 or pBluescript SK+ or SK- ; and sequencing the products to confirm the sequence of cloned fragment;

(e) constructing a gene disruption integrative vector by inserting a kanamycin cassette in between the whiB gene sequences of Mycobacterium tuberculosis H37Rv;

(f) constructing a gene disruption integrative vector by inserting a kanamycin cassette in between the whiB gene sequences of Mycobacterium bovis BCG;

(g) amplifying whiB genes of Mycobacterium tuberculosis H37Rv by using oligonucleotide primers carrying either EcoRI, or BamHI restriction enzyme sites at the 5' end and XhoI restriction enzyme site at the 3' end;

(h) digesting the fragment as obtained in step (g) with suitable restriction enzymes and then cloning the fragment into a E. coli/Saccharomyces cerevisiae shuttle vector pEG202 to produce the cloned gene as a LexA fusion protein and transforming the recombinant plasmid into E. coli;

(i) preparing large amount of the desired recombinant plasmid and then transforming the recombinant whiB1, whiB2, whiB3, and whiB4/pEG202 into the Saccharomyces cerevisiae strains EGY48 and EGY191,

(j) co-transforming the pJK101, pSH 18-34, pSH17-4, pJG4-5 and pRFHM vectors into the Saccharomyces cerevisiae strains EGY48 and EGY191 already harboring whiB genes in the pEG202 vector and then selecting for the clones, which complements for uracil and histidine+uracil or histidine+uracil+tryptophan auxotrophy;

(k) growing the Saccharomyces cerevisiae transformants in the yeast nitrogen base medium containing: galactose/raffinose+, ura-, BU salt+, X-gal+; his-, ura-, BU salt+, X-gal+, glucose; galactose/raffinose+, ura-, his-, leu-; glucose+, ura-, his-, leu-; galactose/raffinose+, ura-, his-, trp-, leu- and glucose+, ura-, his-, trp-, leu- plates, and

(l) using the DNA binding property of the whiB1, whiB2 and whiB3 for the screening of anti-tuberculosis drugs.

In an embodiment, the restriction enzymes are selected from EcoRI, XmaI BamHI, SalI, NcoI, NotI, XhoI, SalI and PstI.

In another embodiment, whiB1 gene is essential for the survival of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

In still another embodiment, the whiB2 gene is essential for the normal growth of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

In yet another embodiment, the whiB3 gene is essential for the cell division of a Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

In an embodiment, the whiB4 gene is essential for the normal growth of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

In another embodiment, the whiB4 gene of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG is a transcription activator.

In yet another embodiment, the whiB1, whiB2 and whiB3 genes of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG code for a DNA binding protein.

In still another embodiment, the whiB1, whiB2 and whiB3 genes of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG repress the activation of .beta.-galactosidase genes after binding to the Lex A operator or any other like operators.

In an embodiment, the DNA binding domain of the whiB genes is situated within the 15 amino acids at the carboxy-terminus of the protein.

In another embodiment, the DNA binding property of the whiB genes has been used to screen those anti-tuberculosis drugs which attack the whiB genes. The method of the invention can be used for any gene, which codes for a DNA binding protein. The method is compatible to any High-Through-Put or automated screening system.

The details of the invention are:

The Mycobacterium tuberculosis H37Rv genome sequence was obtained from the internet site http://www.sanger.ac.uk and the sequence of the whiB genes were recovered. The authors, (Cole et al. Nature, 1998:393, 537-543) have annotated these genes as: whiB1/Rv3219 (255 bp), whiB2/Rv3260c (270 bp), whiB3/Rv3416 (309 bp) and whiB4/Rv3681c (303 bp). The sequence of oligonucleotide primers designed to amplify the whiB genes were as follow:

F 5' acccgttaccagccaagaag 3' and R 5' gggacggttgatgctgtag 3' for whiB1

F5' ggccgggtcagatgatc 3' and R 5'accgcatctgagtttgg 3' for whiB2

F 5' atgccacagccggagcagctac 3' and R 5' ttaagctgtgcggcggatgcc 3' for whiB3

F 5' ctatccggcggtgccggtgcg 3' and R 5' gtggtacgcagcgtagacgcg 3' for whiB4

The sequences of the genes are shown as sequences ID 1 to 4 separately.

The PCR was done by standard procedure. The PCR products were separated on 1 percent agarose gel and the amplified bands were removed by cutting the gel. The PCR amplified DNA was purified by using a commercially available purification kit. Cloning and then transformation of the PCR fragments were done by standard procedure. The sequence of cloned fragments was confirmed by standard procedure.

Once the identity of the cloned fragments was confirmed, the Mycobacterium tuberculosis H37Rv whiB genes were used as probe to check whether similar genes were present in the Mycobacterium bovis BCG or not. The Mycobacterium bovis BCG chromosomal DNA was prepared by a published method (G. P. S. Raghava, R. J. Solanki, V. Soni and P. Agrawal. Biotechniques. 2000. 29:108-116). A standard Southern hybridization protocol was followed to confirm the presence of whiB genes in Mycobacterium bovis BCG as well.

As described for the Mycobacterium tuberculosis H37Rv, all four whiB genes in Mycobacterium bovis BCG were also PCR amplified. The oligonucleotide primers and PCR conditions were identical in both the cases. The PCR products were separated in an agarose gel, purified, cloned and sequenced as described in case of Mycobacterium tuberculosis H37Rv.

The sequence alignment using commercial computer software confirmed that the whiB gene sequences of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG are identical.

By using commercially available computer software Gene-Runner, restriction enzymes sites within the whiB sequences were found. Based on the sequence analysis results following enzyme sites were selected to generate vectors that can be used for gene disruption in Mycobacterium bovis BCG by the process of homologous recombination.

To generate a vector, which could be used for gene disruption the following constructs were created:

(a) for the whiB1, kanamycin cassette was inserted at PvuII site;

(b) for whiB2, two independent constructs were made at MIuI and at HaeIII sites;

(c) for whiB3, two constructs were made at EcoRI site and at the ClaI site;

(d) for whiB4, at the SacII site.

The whiB recombinant clones were digested with restriction enzymes. However, whenever the recombinant clone had more than one site for a particular enzyme then the purified whiB fragments were digested and then ligated with the kanamycin cassette, which codes for kanamycin resistance. The E. coli strain was transformed and clones were selected for ampicillin and kanamycin resistance. Since these clones do not have mycobacterial origin of replication they will not survive within the mycobacteria unless they are integrated in the mycobacteria genome. Electro-competent Mycobacterium bovis BCG cells were prepared using the art known in the literature and transformed with lptg of purified vector DNA. In each tube imi of 7H9 Middlebrook's medium was added and incubated at 37oC. for 48 hrs. The culture was then plated on a 7H 10 Middlebrook's medium containing both ampicillin and kanamycin and incubated at 37oC. After three weeks of growth the colonies were again plated on kanamycin plates and allowed to grow at 37oC. In the kanamycin plates, the colonies could be seen only after 6 weeks of incubation which suggested that the whiB disruption is deleterious for the growth of Mycobacterium bovis BCG. Disruption of individual whiB genes had the following effects on the growth and survival of Mycobacterium bovis BCG:

1. the whiB1 disruption is lethal.

2. the whiB2 disruption makes the cells very slow growing and the colonies are very small in size.

3. the whiB3 disruption makes the cells mycelial which clearly suggests that this disruption is controlling septa formation.

4. the whiB4 disruption also had similar effect like whiB2 disruption.

To demonstrate the nature of the whiB gene, yeast two-hybrid system was used. This art is well known in the literature. In principle the system has been developed in such way that the trans-activation domain and the DNA binding domains are in two different plasmids. Unless both domains come together, protein-protein interaction will not take place thus a gene will not get activated. However, the system also allows one to check whether the gene in question codes for DNA binding protein or a transcription activator.

The whiB1, whiB2 and whiB4 genes were PCR amplified using oligonucleotide primers, which had EcoRI site at their 5' end and XhoI site at their 3' end. The whiB3 gene was amplified with the primers having BamHI site at the 5' end and XhoI site at the 3' end. After digesting with the appropriate restriction enzymes these genes were cloned into the E. coli/Saccharomyces cerevisiae shuttle vector pEG202. After selecting for ampicillin resistant colonies, the recombinant clones were selected for his- colonies in Saccharomyces cerevisiae EGY 48 and EGY 191. The his- clones were then transformed with the plasmids: pJk101, pSH18-34, pJG4-5, and pRFHM either singly or in combinations. The clones which complemented either for uracil, uracil+histidine or uracil+histidine+tryptophan were selected. These clones were then tested for either activation or repression of .beta.-galactosidase activity by growing them in the plates containing yeast-nitrogen based medium and following supplements:

(1) glucose+, ura- BU salt+ +X-gal (no color)

(2) galactose/raffinose+, ura- +BU salt+ +X-gal (no color by all the four whiB genes only when pJK101 is present but pJK101 produced bright blue color, suggesting that whiB genes are expressed in the Saccharomyces cerevisiae and repress the activation of lacZ gene.)

(3) glucose+, ura-,his-,leu- (no growth)

(4) galactose/raffinose+, ura-, his-, leu- (no growth of whiB1, whiB2, and whiB3 but some growth was seen of whiB4 in presence of pSH18-34)

(5) galactose/raffinose+, ura-, his-, tryp-, leu- (only whiB4 showed some growth after three days of incubation in presence of pSH18-34 and pJG4-5, suggesting that the whiB4 gene is a weak transcription activator)

(6) glucose+, ura-, his-, tryp-, leu- (no growth).

Claim 1 of 16 Claims

What is claimed is:

1. A method for making a recombinant Saccharomyces cerevisiae said method comprising the steps of:

a) amplifying one or more whiB-like genes of Mycobacteria by polymerase chain reaction (PCR), wherein the whiB-like genes are selected from the group consisting of whiB1 (SEQ ID NO:1), whiB2 (SEQ ID NO:3), whiB3 (SEQ ID NO:5), and whiB4 (SEQ ID NO:7) and the Mycobacteria are selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis, and Mycobacterium xenopi,

b) cloning the amplified one or more whiB-like genes into a plasmid,

c) transforming the clone into an E. coli using a first shuttle vector,

d) amplifying the clone,

e) introducing the amplified clone into a second shuttle vector,

f) introducing the second shuttle vector into Saccharomyces cerevisiae, and

g) obtaining transformed Saccharomyces cerevisiae.




____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]