Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 


Title:  Collagen-binding proteins from streptococcus pyogenes

United States Patent:  6,777,547

Issued:  August 17, 2004

Inventors:  Podbielski; Andreas (Heilmeyersteige 158/4, D-89075 Ulm, DE)

Appl. No.:  494297

Filed:  January 31, 2000

Abstract

Isolated proteins, designated Cpa1 and Cpa49, and their corresponding amino acid and nucleic acid sequences are provided which are useful in the prevention and treatment of infection caused by group A streptococcal bacteria such as Streptococcus pyogenes. These proteins have been observed to bind to collagen, and thus methods are provided, such as by administration of the proteins or antibodies generated thereto, whereby streptococcal binding of collagen can be inhibited, and streptococcal infection can be greatly reduced. In addition, medical instruments can be treated using the collagen-binding proteins of the invention in order to reduce or eliminate the possibility of their becoming infected or further spreading the infection. In particular, the proteins are advantageous because they may be used as vaccine components or antibodies thereof, and they may be administered to wounds or used to coat biomaterials in order to act as collagen blocking agents and reduce or prevent severe infection by group A streptococcal bacteria.

SUMMARY OF THE INVENTION

Accordingly, it is an object of the present invention to provide isolated proteins (adhesins) from group A streptococci which can bind to intercellular matrix proteins such as collagen so as to be useful in dev loping m thods of inhibiting collag n binding and attachment of streptococcal bacteria to cells.

It is a further object of the present invention to provide isolated streptococcal surface proteins that are able to inhibit adhesion to the immobilized extracellular matrix or host cells present on the surface of implanted biomaterials.

It is a further object of the present invention to provide a vaccine which can be used in treating or preventing infection by group A streptococcal bacterial such as Streptococcus pyogenes.

It is still further an object of the present invention to generate antisera and antibodies to the collagen binding proteins from GAS which can also be useful in developing methods of treatment which can inhibit binding of the streptococcal bacteria to host cells or to implanted biomaterials and thus be employed in order to treat or prevent Streptococcal infection.

It is a further object of the present invention to provide improved materials and methods for detecting and differentiating collagen-binding proteins in streptococcal organisms in clinical and laboratory settings.

It is a further object of the invention to provide nucleic acid sequences which code for the collagen binding proteins in GAS which can also be useful in producing the collagen-binding proteins of the invention and in developing probes and primers specific for identifying and characterizing these proteins.

These and other objects are provided by virtue of the present invention which comprises isolated collagen binding prot ins from group A streptococcal bact ria such as Streptococcus pyogenes along with their amino acid and nucleic acid sequ nces. Two of the specific proteins isolated in accordance with the invention are designated Cpa1 and Cpa49 which are obtained from the collagen binding region in Streptococcus pyogenes, and the sequences for these proteins are those as shown in SEQ ID NOS. 2 and 4, respectively. The nucleic acid sequences coding for Cpa1 and Cpa49 are shown in SEQ ID NOS. 1 and 3, respectively. The isolated proteins of the present invention have been observed to bind to collagen, and thus can be utilized in methods of treating or preventing streptococcal infection through the inhibition of the ability of the bacteria to bind to collagen.

In another aspect of the present invention, there is also provided antisera and antibodies generated against the collagen binding proteins of the present invention which also can be utilized in methods of treatment which involve inhibition of the attachment of the Cpa proteins to collagen. In particular, specific polyclonal antiserum against Cpa has been generated which has been shown to react with Cpa in Western immunoblots and ELISA assays and which interferes with Cpa binding to collagen. This antiserum can thus be used for specific agglutination assays to detect bacteria which express Cpa on their surface. The antiserum apparently does not cross-react with bacteria which express the fibronectin-binding protein F1 on their surface despite the fact that a portion of protein F1 exhibits sequence homologies to Cpa1 to Cpa49.

Accordingly, in accordance with the invention, antisera and antibodies raised against the Cpa1 and Cpa49 proteins, or portions thereof, may be employed in vaccines, and other pharmaceutical compositions containing the prot ins for therapeutic purposes are also provided herein. In addition, diagnostic kits containing the appropriate nucleic acid molecules, the Cpa1 or Cpa49 proteins, or antibodies or antisera raised against them are also provided so as to detect bacteria expressing these proteins.

These embodiments and other alternatives and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the present specification and/or the references cited herein.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

In accordance with the present invention, there is provided isolated collagen binding proteins from group A streptococcal bacteria, and their corresponding amino acid and nucleic acid sequences are described herein. Two specific proteins isolated in accordance with the present invention are designated Cpa1, having the nucleic acid sequence as shown in SEQ ID NO. 1 and the amino acid sequences of SEQ ID NO. 2, and Cpa49, which has the nucleic acid sequence as shown in SEQ ID NO. 3 and the amino acid sequence observed in SEQ ID NO. 4. Using different experimental approaches, it has now been shown that Cpa1 and Cpa49 both bind to collagen, e.g., via binding of soluble 125-iodine labeled collagen, inhibition of binding to immobilized collagen by recombinant purified Cpa1 protein and by specific antisera directed to Cpa49/Cpa1, and thus these prot ins or their antibodies can thus be useful in the treatment and prevention of group A streptococcal disease, or in techniques to id ntify such prot ins, as described further below. It has also been det mined via collag n binding experiments with recombinant purified Cpa-fragments, that the collagen binding domain can be deduced to reside in the third (C-terminal) quarter of the protein.

In addition to the structures of Cpa1 and Cpa49 as shown in the amino acid sequences of SEQ ID NOS. 2 and 4, respectively, as would be recognized by one of ordinary skill in this art, modification and changes may be made in the structure of the peptides of the present invention and DNA segments which encode them and still obtain a functional molecule that encodes a protein or peptide with desirable characteristics. The amino acids changes may be achieved by changing the codons of the DNA sequence. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence, and, of course, its underlying DNA coding sequence, and nevertheless obtain a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the peptide sequences of the disclosed compositions, or corresponding DNA sequences which encode said peptides without appreciable loss of their biological utility or activity.

In addition, amino acid substitutions are also possible without affecting th collagen binding ability of the isolated proteins of the invention, provided that the substitutions provide amino acids having sufficiently similar properties to the ones in the original sequences.

Accordingly, acceptable amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspertate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. The isolated proteins of the present invention can be prepared in a number of suitable ways known in the art including typical chemical synthesis processes to prepare a sequence of polypeptides.

The synthetic polypeptides of the invention can thus be prepared using the well known techniques of solid phase, liquid phase, or peptide condensation techniques, or any combination thereof, can include natural and unnatural amino acids. Amino acids used for peptide synthesis may be standard Boc (Na -amino protected Na -4-butyloxycarbonyl) amino acid resin with the standard deprotecting, neutralization, coupling and wash protocols of the original solid phase procedure of Merrifield (J. Am. Chem. Soc., 85:2149-2154, 1963), or the base-labile Na -amino protected 9-fluorenylmethoxycarbonyl (Fmoc) amino acids first described by Carpino and Han (J. Org. Chem., 37:3403-3409, 1972). Both Fmoc and Boc Na -amino protected amino acids can be obtained from Fluka, Bachem, Advanced Chemtech, Sigma, Cambridg Research Biochemical, Bachem, or Peninsula Labs or other chemical companies familiar to those who practice this art. In addition, the method of the invention can be used with other Na -protecting groups that are familiar to those skilled in this art. Solid phase peptide synthesis may be accomplished by techniques familiar to those in the art and provided, for example, in Stewart and Young, 1984, Solid Phase Synthesis, Second Edition, Pierce Chemical Co., Rockford, Ill.; Fields and Noble, 1990, Int. J. Pept Protein Res. 35:161-214, or using automated synthesizers, such as solid by ABS. Thus, polypeptides of the invention may comprise D-amino acids, a combination of D- and L-amino acids, and various "designer" amino acids (e.g., .beta.-methyl amino acids, C.alpha.-methyl amino acids, and N.alpha.-methyl amino acids, etc.) to convey special properties. Synthetic amino acids include omithine for lysine, fluorophenylalanine for phenylalanine, and norleucine for leucine or isoleucine. Additionally, by assigning specific amino acids at specific coupling steps, .alpha.-helices, .beta. turns, .beta. sheets, .gamma.-turns, and cyclic peptides can be generated.

In a further embodiment, subunits of peptides that confer useful chemical and structural properties will be chosen. For example, peptides comprising D-amino acids will be resistant to L-amino acid-specific proteases in vivo. In addition, the present invention envisions preparing peptides that have more well defined structural properties, and the use of peptidomimetics and peptidomimetic bonds, such as ester bonds, to prepare peptides with novel properties. In another embodiment, a peptide may be generated that incorporates a reduced peptide bond, i. ., R1 --CH2 --NH--R2, wh re R1 and R2 are amin acid residues or sequences. A reduced peptid bond may be introduced as a dipeptide subunit. Such a molecul would be resistant t peptid bond hydrolysis, e.g., protease activity. Such peptides would provide ligands with unique function and activity, such as extended half-lives in vivo due to resistance to metabolic breakdown or protease activity. It is also well known that in certain systems, constrained peptides show enhanced functional activity (Hruby, Life Sciences, 31:189-199, 1982); (Hruby et al., Biochem J., 268:249-262, 1990).

Also provided herein are sequences of nucleic acid molecules that selectively hybridize with nucleic acid molecules encoding the collagen-binding proteins of the invention, or portions thereof, such as consensus or variable sequence amino acid motifs, from Streptococcus pyogenes described herein or complementary sequences thereof. By "selective" or "selectively" is meant a sequence which does not hybridize with other nucleic acids. This is to promote specific detection of Cpa1 to Cpa49. Therefore, in the design of hybridizing nucleic acids, selectivity will depend upon the other components present in a sample. The hybridizing nucleic acid should have at least 70% complementarity with the segment of the nucleic acid to which it hybridizes. As used herein to describe nucleic acids, the term "selectively hybridizes" excludes the occasional randomly hybridizing nucleic acids, and thus, has the same meaning as "specifically hybridizing". The selectively hybridizing nucleic acids of the invention can have at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, and 99% complementarity with the segment of the sequence to which they hybridize.

The invention contemplates sequences, probes and primers which selectiv ly hybridize to the encoding DNA or the complementary, or opposite, strand of DNA as those specifically provided herein. Specific hybridization with nucleic acid can occur with minor modifications or substitutions in the nucleic acid, so long as functional species-specific hybridization capability is maintained. By "probe" is meant nucleic acid sequences that can be used as probes or primers for selective hybridization with complementary nucleic acid sequences for their detection or amplification, which probes can very in length from about 5 to 100 nucleotides, or preferably from about 10 to 50 nucleotides, or most preferably about 18-24 nucleotides. Therefore, the terms "probe" or "probes" as used herein are defined to include "primers". Isolated nucleic acids are provided herein that selectively hybridize with the species-specific nucleic acids under stringent conditions and should have at least 5 nucleotides complementary to the sequence of interest as described by Sambrook et al., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

If used as primers, the composition preferably includes at least two nucleic acid molecules which hybridize to different regions of the target molecule so as to amplify a desired region. Depending on the length of the probe or primer, the target region can range between 70% complementary bases and full complementarity and still hybridize under stringent conditions. For example, for the purpose of diagnosing the presence of the S. pyogenes, the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes ( .g., group A streptococcal DNA from a sample) is at least enough to distinguish hybridization with a nucleic acid from other bacteria.

The nucleic acid sequences encoding Cpa1 or Cpa49 proteins or portions thereof, such as consensus or variable amino acid motifs, can be inserted into a vector, such as a plasmid, and recombinantly expressed in a living organism to produce recombinant Cpa1 or Cpa49 proteins or active fragments thereof.

Recombinant proteins are produced by methods well known to those skilled in the art. A cloning vector, such as a plasmid or phage DNA is cleaved with a restriction enzyme, and the DNA sequence encoding the Cpa1 or Cpa49 protein or active fragments thereof, such as consensus or variable sequence amino acid motifs, is inserted into the cleavage site and ligated. The cloning vector is then inserted into a host to produce the protein or fragment encoded by the Cpa1 or Cpa49 encoding DNA. Suitable hosts include bacterial hosts such as Escherichia coli, Bacillus subtilis, yeasts and other cell cultures. Production and purification of the gene product may be achieved and enhanced using known molecular biology techniques.

In accordance with the present invention, we have sequenced an 11.5 kb genomic fragment of serotype M49 GAS strain CS101 harboring the nra gene that is 63% homologous to the rofA positive regulatory gene. In contrast to the apparent function of rofA, nra was found to encode a negative regulator affecting its own expression, the expression of two adjacent operons and several other genes. Some of these genes encode potentional intracellular proteins, whereas other encode surface prot ins such as the collagen-binding CPA (this study) and th fibronectin-binding PrtF2 (Jaffe t al., 1996), which may be involved in virulence. In addition, nra influences the expression of the mga regulatory gene and, thereby, th factors contained in the mga region. Expression of nra was found to be maximal in early stationary phase and was not significantly influenced by atmospheric conditions. Overall, the present invention includes the identification of a unique GAS negative regulator and implicates its function in a regulatory network affecting virulence factor expression in GAS, as set forth in detail in Podbielski et al., Molecular Microbiol. 31(4):1051-1064 (1999), incorporated herein by reference.

In accordance with the present invention, an analysis was undertaken of the genomic region containing the nra gene. In this analysis, an 11 489 bp portion of the GAS chromosome was sequenced from a Lambda library of the serotype M49 GAS genome (GenBank accession no. U 49397). Computer analysis of this sequence revealed the present of nine complete and two petal predicted open reading frames (ORFs). Homology comparisons with GenBank entries demonstrated the similarity of 10 of the ORFs to known bacterial protein sequences (Table 1). Detailed analysis of the gene products encoded in this region (see the following sections) revealed the presence of a negative regulatory gene, nra, and immediately upstream in the opposite orientation, a collagen-binding protein, cpa. The genomes of GAS serotypes in GenBank and the available streptococcal serotype M1 genomic sequences (Roe et al., 1997) were searched for homologues to nra and cpa. The gene sharing the highest degree of homology with nra was the positive regulatory factor, rofA, whil cpa showed the highest homology t a gene for a fibronectin-binding protein, prtF.

A more detailed computer analysis of the similarity between the negative regulator nra and the positive regulator rofA showed that both contain similar N-terminal double helix-turn-helix motifs whose intramolecular localization would be consistent with a negative or dual regulatory function of the proteins (Prag et al., 1997). Homology between the collagen-binding cpa genes and the fibronectin-binding prtF genes was confirmed to the N-terminal sections and did not include the portions of prtF encoding its two fibronectin binding domains (Taley et al., 1994; Ozeri et al., 1996; Sela et al., 1993). The genes of fibronectin-binding proteins F have at least two isotypes, prtF (Hanski and Caparon, 1992) and srb (Talay et al., 1992), which exhibit 52% sequence homology. Similarly the genes of collagen-binding proteins, cpa, also appeared to have multiple forms such as cpa in M49 and cpa.1 in M1, which shared approximately 53% homology to each other and 23% homology to the prtF family of proteins.

In order to confirm and extend the results of the sequence comparisons, oligonucleotides specific for prtF (Natanson et al., 1995), prtF2, cpa (M49/M1), nra and rofA genes (Table 4) were synthesized. These oligonucleotides were uses as polymerase chain reaction (PCR) primers on genomic DNA from serotypes M1, M2, M3, M4, M5, M6, M12, M18, M24 (Table 2) and eight independent M49 strains. In addition, the primers were used to generate probes for Southern blot hybridizations that were performed with EcoRI- and HindiII-digested genomic DNA of the 10 serotype strains (Tabl 2). Based on the results from both analyses, no variation was found within the M49 serotype. However, different M protein serotype strains harbored ither rofA, nra or both genes. Any combination of regulator and binding protein (cpa, prtF, prtF2) could also be found. Therefore, the nra/cpa and rofA/prtF pairs are not mutually exclusive, and single strains can also contain any combination of regulators and binding proteins. What was particularly striking was that, although M49- and M1-contained gene pairs had different regulatory proteins (cpa/nra and cpa.1/rofA.1 respectively), the binding the regulatory genes were flanked by five genes sharing >96% homology and three genes with <50% homology that indicated that cpa and nra could be part of a pathogenicity island. In the serotype M49 strain used for further study, in addition to the cpa/nra gene pair, a prtF2 gene was contained in a separate location on the GAS chromosome. The localization of other regulator/binding protein pairs, especially in strains containing multiple regulators or binding proteins, awaits further analysis.

The transcriptional organization of nra, cpa and flanking genes was determined by Northern blotting using PCR-generated specific probes (see Table 4 for primer sequences). Each Northern blot was repeated three or four times, and the results are given in FIG. 2. To determine the affect of nra on the transcription of itself and neighboring genes, an nra mutant was constructed by genomic insertion of the plasmid pFW11. The construct was confirmed by Southern blot hybridization and specific PCRs using nra mutant genomic DNA (data not shown). As transcription of rofA, the gene sharing the greatest homology to nra, is increased und r a robic conditions, th Northern analyses were carried out on RNA isolated from cells grown und r both aerobic and anaerobic conditions. It should be noted that nra was transcribed at very low rates and was barely detectable in 80 .mu.g of total RNA.

The nra region was found to be monocistronically transcribed (.apprxeq.1.8 kb) and upregulated in an nra mutant. Transcription was slightly, although probably not significantly, induced under aerobic conditions. The three genes immediately downstream of nra, ORF5-nifR3L-kinL, were transcribed as an operon whose 2.6 kb transcript, as detected with a nifR3L probe. The ORF4-kinL operon was expressed at higher levels under aerobic conditions and in an nra mutant, suggesting that this operon falls under the control of nra. The different transcription rates of nifR3L in wild-type and nra mutant strains were confirmed by Northern blots performed on serial dilutions of total mRNA. Reverse transcriptase (RT)-PCR carried out on total mRNA using primers described to the 3' end of nra and the 5' end of ORF5 yielded a product that would be present only if at least some transcriptional readthrough occurs between nra and ORF5 (data not shown). Thus, inverted repeats present in the non-coding section between nra and ORF5 serve only as a weak transcriptional terminator, allowing a small amount of readthrough between nra and ORF5. However, the majority of the nifR3L transcript originates from a second promoter upstream of ORF5, as only the ORF5-kinL transcript could be visualized on the Northern blots. Because insertion of pFW11 in nra disrupted readthrough between nra and ORF5, the only promoter still present in the nra mutants was th promot r ahead of ORF5. As the ORF5-kinL product was still increased in the nra mutants, it indicates that nra also has a negativ regulatory affect at the promoter immediat ly upstream of ORF5.

Northern analyses using a cpa probe detected a 5.2 kb transcript composed of the four genes (cpa-ORF2) located immediately upstream of and in the opposite orientation to nra. Transcription of the cpa operon was also increased in an nra mutant, suggesting its regulation by nra. However, unlike the nra and ORF5-kinL transcripts, the cpa-ORF2 transcript was more abundant under anaerobic conditions, suggesting a possible superimposed second regulatory mechanism for this operon.

Northern blots using a prtF2 probe detected an mRNA consistent in size with a monocistronic transcription of prtF2. Although the gene is located at a distant site in the chromosome, increased transcription of an nra mutant was detected, and its expression is increased under aerobic conditions. However, the effects of nra mutation did not generally influence mRNA transcription rate or stability, as the recA transcript was not affected in the nra mutant (data not shown).

As nra appeared to be a global negative regulator of virulence factors. Northern blots were used to determine whether nra and the global positive virulence factor regulator mga affected each other. Levels of mga mRNA were increased in the nra mutant (Podbielski et al., 1995) for Northern blot analysis, the nra message was found to be decreased in the mga mutant, which led to a corresponding increase in the nifR3L and cpa transcripts that are negativ ly regulated by nra.

Taken together, the data from the different transcript analyses indicate that the nra gene product is a negativ regulator of its own expression and the two adjacent operons as well as of prF2 and mga. The mga regulator, in turn, was suggested to be a positive regulator of nra expression and, thus, an indirect suppressor of nra-dependent genes.

With regard to the gene coding for the collagen-binding region of the group A streptococci, the cpa gene was demonstrated to be negatively regulated by the nra gene product. To determine whether CPA was involved in matrix molecule interactions, a recombinant CPA-maltose binding protein fusion was expressed in Escherichia coli. After purification and labeling, it was subjected to an enzyme-linked binding assay with the immobilized human matrix proteins, collagen type 1, fibronectin and laminin. Using the purified maltose-binding protein as a negative control, the Cpa-fusion protein bound significantly to collagen and, to a lesser extent, to laminin (P<0.05 as determined by the Wilcoxon range test) (Table 3). Binding of Cpa to fibronectin and BSA remained at the level of the maltose-binding protein alone. Thus, like protein F2, Cpa is a second nra-controlled, potential GAS surface protein, exhibiting human matrix protein-binding properties.

The regulation of these binding proteins by nra would predict that stationary phase M49 nra mutants may still contain Cpa and protein F2, as they continue to transcribe cpa and prtF2 upon entry into stationary phase. This could result in better fibronectin and collagen binding by stationary phase nra mutants. To t st this prediction M49 wild type and nra mutant strains were cultured on plates under anaerobic conditions until stationary phase was reached. The cells were harvested, fluorescein isothiocyanate (FITC) labeled and the binding of the two strains to immobilized collagen and fibronectin was measured. The nra mutant exhibits significantly increased binding to both matrix proteins compared with the wild type. Collagen-binding assays conducted with unmarked cells that were detected with labeled polyclonal serum yielded similar results (data not shown), suggesting that the FITC-labeling protocol did not damage the cells or alter binding significantly. As recombinant Cpa was found to block the binding of FITC-labeled GAS to immobilized collagen (data not shown), the binding of cells to collagen is probably mediated through the interaction of Cpa and collagen. Overall, these data indicate that, while wild-type bacteria could decrease their affinity to matrix proteins when entering stationary growth phase, the nra mutants no longer had this ability.

The organization of the genomic regions controlled by nra were remarkably similar to those flanking rofA. The five downstream genes were more than 98% homologous. The upstream four-gene operon structure was conserved for both regulators. However, the homology of these genes was only 43-52% across serotypes. In rofA-containing M5, the first gene upstream was the fibronectin-binding protein gene, prtF. In the rofA-containing serotype M1 and the nra-containing serotype M49, the first gene of the upstream operon consisted of a novel gene, cpa. Protein purification and binding studies showed that cpa encoded a collagen-binding protein that was unable to bind fibronectin. Further PCR and Southern hybridization analysis of other GAS M serotypes confirmed that there was no correlation between the regulat r (nra/rofA) and the binding prot in contained in the upstream operon (prtF/cpa). In addition, strains were found that contained both regulators and/or multiple binding proteins. For example, serotype M49 contained an nra/cpa pair. However, a prtF2 gene located lsewhere in the chromosome was monocistronically transcribed and still negatively regulated by nra. The presence of both the positive rofA regulator and the negative nra regulator in the serotype M5 and the presence of only rofA in serotype M6 may explain the influences of genomic background noted during studies of RofA regulation in these serotypes (Van Heyningen et al., 1993; Fogg and Caparon, 1997).

The expression of nra during growth was followed using a luciferase reporter gene fused to the 3' end of nra. The high-sensitivity detection of luciferase activity by a luminometer coupled with the 10 min half-life of luciferase in GAS (unpublished results) allowed the analysis of luc-fusion activity even at low cell densities. nra was transcribed at the highest rate during early stationary phase and was not significantly influenced by atmospheric conditions. This was in contrast to rofA, which has been described as being maximally active under aerobic conditions (Fogg and Caparon, 1997). The differences in these results could reflect either differences in sensor capacity between rofA and nra or a methodological difference in the assay methods used. The rofA measurements were done by determining the level of an accumulated stable .beta.-galactosidase reporter from a multicopy plasmid obtained using the experimental procedures described in the examples below.

In addition to the Cpa prot ins abov in various procedures, including th detection of the presence of Cpa1 r Cpa49 or their antibodies, the present inv tion also contemplates the use of the nucleic acids described herein to detect and identify the presence of collagen-binding GAS as well. The methods are useful for diagnosing group A streptococcal infections and other streptococcal diseases such as may occur in catheter related infections, biomaterial related infections, respiratory tract infections, cardiac, gastrointestinal or central nervous system infections, ocular infections, wound infections, skin infections, and a myriad of other diseases including conjunctivitis, keratitis, cellulitis, mycsitis, septic arthritis, osteomyelitis, bovine mastitis, and canine pyoderma, all as affected by group A streptococcal bacteria.

In accordance with the invention, a preferred method of detecting the presence of Cpa1 or Cpa49 proteins involves the steps of obtaining a sample suspected of containing group A streptococci. The sample may be taken from an individual, for example, from one's blood, saliva, tissues, bone, muscle, cartilage, or skin. The cells can then be lysed, and the DNA extracted, precipitated and amplified. Detection of DNA from group A streptococci can be achieved by hybridizing the amplified DNA with a probe for GAS that selectively hybridizes with the DNA as described above. Detection of hybridization is indicative of the presence of group A streptococci.

Preferably, detection of nucleic acid (e.g. probes or primers) hybridization can be facilitated by the use of detectable moieties. For example, the probes can be labeled with biotin and used in a streptavidin-coated microtiter plate assay. Other detectable moieties include radioactiv labeling, nzyme labeling, and fluorescent labeling, for exampl .

DNA may be detected directly or may be amplified enzymatically using polymerase chain reaction (PCR) or other amplification techniques prior to analysis. RNA or DNA can be similarly detected. Increased or decreased expression of Cpa1 or Cpa49 can be measured using any of the methods well known in the art for the quantification of nucleic acid molecules, such as, for example, amplification, PCR, RT-PCR, RNase protection, Northern blotting, and other hybridization methods.

Diagnostic assays for Cpa1 or Cpa49 proteins or active proteins thereof, such as consensus or variable sequence amino acid motifs, or anti-Cpa1 or Cpa49 antibodies may also be used to detect the presence of a streptococcal bacterium such as Streptococcus pyogenes. Assay techniques for determining protein or antibody levels in a sample are well known to those skilled in the art and include methods such as radioimmunoasssay, Western blot analysis and ELISA assays.

The isolated, recombinant or synthetic proteins of the present invention, or antigenic portions thereof (including epitope-bearing fragments), or fusion proteins including the CPa1 or CPa49 proteins as described above, can be administered to animals as immunogens or antigens, alone or in combination with an adjuvant, for the production of antibodies reactive with Cpa1 or Cpa49 proteins or portions thereof. In addition, the proteins can be used to screen antibodies or antisera for hyperimmune patients from whom can be derived specific antibodies having a very high affinity for the proteins.

Antibodies to Cpa1 or Cpa49, or to fragments thereof, can also be used in accordance with the invention for the specific d tection of collag n-binding streptococcal proteins, for the prevention of infection from group A streptococci, for the treatment of an ongoing infection, or for use as research tools. The term "antibodies" as used herein includes monoclonal, polyclonal, chimeric, single chain, bispecific, simianized, and humanized or primatized antibodies as well as Fab fragments, including the products of an Fab immunoglobulin expression library. Generation of any of these types of antibodies or antibody fragments is well known to those skilled in the art. In the present case, specific polyclonal antiserum against Cpa has been generated which reacts with Cpa in Western immunoblots and ELISA assays and interferes with Cpa binding to collagen. The antiserum can be used for specific agglutination assays to detect bacteria which express Cpa on their surface. The antiserum does not cross-react with bacteria which express the fibronectin-binding protein F1 on their surface, although a protein of protein F1 exhibits sequence homologies to Cpa1 and Cpa49.

Any of the above described antibodies may be labeled directly with a detectable label for identification and quantification of group A streptococci. Labels for use in immunoassays are generally known to those skilled in the art and include enzymes, radioisotopes, and fluorescent, luminescent and chromogenic substances, including colored particles such as colloidal gold or latex beads. Suitable immunoassays include enzyme-linked immunosorbent assays (ELISA).

Alternatively, the antibody may be labeled indirectly by reaction with labeled substances that hav an affinity for immunoglobulin. The antibody may be conjugated with a second substance and detected with a labeled third substance having an affinity for the second substance conjugated to the antibody. For exampl , the antibody may be conjugated to biotin and the antibody-biotin conjugate detected using labeled avidin or straptavidin. Similarly, the antibody may be conjugated to a hapten and the antibody-hapten conjugate detected using labeled anti-hapten antibody. These and other methods of labeling antibodies and assay conjugates are well known to those skilled in the art.

Antibodies to the collagen-binding proteins Cpa1 or Cpa49, or portions thereof, may also be used in production facilities or laboratories to isolate additional quantities of the proteins, such as by affinity chromatography. For example, antibodies to the collagen-binding protein Cpa1 or Cpa49 may also be used to isolate additional amounts of collagen.

The isolated proteins of the present invention, or active fragments thereof, and antibodies to the proteins may be useful for the treatment and diagnosis of group A streptococcal bacterial infections as described above, or for the development of anti-group A streptococcal vaccines for active or passive immunization. Further, when administered as pharmaceutical composition to a wound or used to coat medical devices or polymeric biomaterials in vitro and in vivo, both the proteins and the antibodies are useful as blocking agents to prevent or inhibit the binding of group A streptococci to the wound site or the biomaterials themselves. Preferably, the antibody is modified so that it is less immunogenic in the patient to whom it is administered. For example, if the patient is a human, the antibody may be "humanized" by transplanting the complimentarity determining regions of the hybridoma-derived antibody into a human monoclonal antibody as described, .g., by Jones t al., Nature 321:522-525 (1986) or Tempest et al. Biotechnology 9:266-273 (1991).

Medical devices or polymeric biomaterials to be coated with the antibodies, proteins and active fragments described herein include, but are not limited to, staples, sutures, replacement heart valves, cardiac assist devices, hard and soft contact lenses, intraocular lens implants (anterior chamber or posterior chamber), other implants such as corneal inlays, kerato-prostheses, vascular stents, epikeratophalia devices, glaucoma shunts, retinal staples, scleral buckles, dental prostheses, thyroplastic devices, laryngoplastic devices, vascular grafts, soft and hard like tissue protheses including, but not limited to, pumps, electrical devices including stimulators and recorders, auditory prostheses, pacemakers, artificial larynx, dental implants, mammary implants, penile inplants, cranio/facial tendons, artificial joints, tendons, ligaments, menisci, and disks, artificial bones, artificial organs including artificial pancreas, artificial hearts, artificial limbs, and heart valves; stents, wires, guide wires, intravenous and central venous catheters, laser and balloon angioplasty devices, vascular and heart devices (tubes, catheters, balloons), ventricular assists, blood dialysis components, blood oxygenators, urethral/ureteral/urinary devices (Foley catheters, stents, tubes and balloons), airway catheters (endotracheal and tracheostomy tubes and cuffs), enteral feeding tubes (including nasogastric, intragastric and jejunal tubes), wound drainage tubes, tubes used to drain the body cavities such as the pleural, peritoneal, cranial, and pericardial cavities, blood bags, test tubes, blood collection tubes, vacutainers, syringes, needles, pipettes, pipett tips, and blood tubing.

It will be understood by those skilled in the art that the term "coated" or "coating", as used herein, means to apply the protein, antibody or active fragment to a surface of the device, preferably an outer surface that would be exposed to streptococcal bacterial infection. The surface of the device need not be entirely covered by the protein, antibody or active fragment.

In addition, the present invention may be utilized as immunological compositions, including vaccines, and other pharmaceutical compositions containing the Cpa1 or Cpa49 proteins or portions thereof are included within the scope of the present invention. Either one or both of the Cpa1 or Cpa49 proteins, or active or antigenic fragments thereof, or fusion proteins thereof, can be formulated and packaged, alone or in combination with other antigens, using methods and materials known to those skilled in the art for vaccines. The immunological response may be used therapeutically or prophylactically and may provide antibody immunity or cellular immunity, such as that produced by T lymphocytes.

The immunological compositions, such as vaccines, and other pharmaceutical compositions can be used alone or in combination with other blocking agents to protect against human and animal infections caused by or exacerbated by group A streptococci. In particular, the compositions can be used to protect humans against skin infections such as impetigo and eczema, as well as mucous membrane infections such as tonsillopharyngitis. In addition, effectiv amounts of the compositions of th present invention may be used to protect against complications caused by localized infections such as sinusitis, mastoiditis, parapharygeal abscesses, cellulitis, necrotizing fascitis, myositis, streptococcal toxic shock syndrome, pneumonitis endocarditis, meningitis, osteomylitis, and many other sever diseases. Further, the present compositions can be used to protect against nonsuppurative conditions such as acute rheumatic fever; acute glomerulonephritis, obsessive/compulsive neurologic disorders and exacerbations of forms of psoriasis such as psoriasis vulgaria. The compositions may also be useful as appropriate in protecting both humans and other species of animals where needed to combat similar group A streptococcal infections.

To enhance immunogenicity, the proteins may be conjugated to a carrier molecule. Suitable immunogenic carriers include proteins, polypeptides or peptides such as albumin, hemocyanin, thyroglobulin and derivatives thereof, particularly bovine serum albumin (BSA) and keyhole limpet hemocyanin (KLH), polysaccharides, carbohydrates, polymers, and solid phases. Other protein derived or non-protein derived substances are known to those skilled in the art. An immunogenic carrier typically has a molecular weight of at least 1,000 Daltons, preferably greater than 10,000 Daltons. Carrier molecules often contain a reactive group to facilitate covalent conjugation to the hapten. The carboxylic acid group or amine group of amino acids or the sugar groups of glycoproteins are often used in this manner. Carriers lacking such groups can often be reacted with an appropriate chemical to produce them. Preferably, an immune response is produced when the immunogen is injected into animals such as mice, rabbits, rats, goats, sheep, guinea pigs, chickens, and other animals, most preferably mice and rabbits. Alternativ ly, a multipl antigenic peptid comprising multipl copies of the protein or polypeptide, or an antigenically or immunologically equivalent polypeptide may be sufficiently antigenic to improve immunogenicity without the use of a carrier.

The Cpa1 or Cpa49 proteins or portions thereof, or combination of proteins, may be administered with an adjuvant in an amount effective to enhance the immunogenic response against the conjugate. At this time, the only adjuvant widely used in humans has been alum (aluminum phosphate or aluminum hydroxide). Saponin and its purified component Quil A, Freund's complete adjuvant and other adjuvants used in research and veterinary applications have toxicities which limit their potential use in human vaccines. However, chemically defined preparations such as muramyl dipeptide, monophosphoryl lipid A, phospholipid conjugates such as those described by Goodman-Snitkoff et al. J. Immunol. 147:410-415 (1991) and incorporated by reference herein, encapsulation of the conjugate within a proteoliposome as described by Miller et al., J. Exp. Med. 176:1739-1744 (1992) and incorporated by reference herein, and encapsulation of the protein in lipid vesicles such as Novasome.TM. lipid vesicles (Micro Vescular Systems, Inc., Nashua, N.H.) may also be useful.

The term "vaccine" as used herein includes DNA vaccines in which the nucleic acid molecule encoding for a collagen-binding Gas protein, such as the nucleic acid sequences disclosed herein as SEQ ID NOS. 1 or 3, as used in a pharmaceutical composition is administered to a patient. For genetic immunization, suitable delivery methods known to those skilled in the art include direct injection of plasmid DNA into muscles (Wolff et al., Hum. Mol. Genet. 1:363, 1992), delivery of DNA complexed with specific protein carriers (Wu et al., J. Biol. Chem. 264:16985, 1989), coprecipitation of DNA with calcium phosphate (Benvenisty and Reshef, Proc. Natl. Acad. Sci. 83:9551, 1986), encapsulation of DNA in liposomes (Kaneda et al., Science 243:375, 1989), particle bombardment (Tang et al., Nature 356:152, 1992 and Eisenbraun et al., DNA Cell Biol. 12:791, 1993), and in vivo infection using cloned retroviral vectors (Seeger et al., Proc. Natl. Acad. Sci. 81:5849, 1984).

In another embodiment, the invention is a polynucleotide which comprises contiguous nucleic acid sequences capable of being expressed to produce a gene product upon introduction of said polynucleotide into eukaryotic tissues in vivo. The encoded gene product preferably either acts as an immunostimulant or as an antigen capable of generating an immune response. Thus, the nucleic acid sequences in this embodiment encode an immunogenic epitope, and optionally a cytokine or a T-cell costimulatory element, such as a member of the B7 family of proteins.

There are several advantages of immunization with a gene rather than its gene product. The first is the relative simplicity with which native or nearly native antigen can be presented to the immune system. Mammalian proteins expressed recombinantly in bacteria, yeast, or even mammalian cells often require extensive treatment to ensure appropriate antigenicity. A second advantage of DNA immunization is the potential for the immunogen to enter the MHC class I pathway and evoke a cytotoxic T cell response. Immunization of mice with DNA encoding the influenza A nucleoprotein (NP) elicited a CD8+ response to NP that protected mice against challenge with heterologous strains of flu. (See Montgomery, D. L. et al., Cell Mol Biol, 43(3):285-92, 1997 and Ulmer, J. et al., Vaccine, 15(8):792-794, 1997.)

Cell-mediated immunity is important in controlling infection. Since DNA immunization can evoke both humoral and cell-mediated immune responses, its greatest advantage may be that it provides a relatively simple method to survey a large number of S. pyogenes genes for their vaccine potential.

Pharmaceutical compositions containing the Cpa1 or Cpa49 proteins or portions thereof, nucleic acid molecules, antibodies, or fragments thereof, may be formulated in combination with a pharmaceutical excipient or carrier such as saline, dextrose, water, glycerol, ethanol, other therapeutic compounds, and combinations thereof. The formulation should be appropriate for the mode of administration. The compositions are useful for interfering with, modulating, or inhibiting binding interactions between streptococcal bacteria and collagen on host cells.

The amount of expressible DNA or transcribed RNA to be introduced into a vaccine recipient will have a very broad dosage range and may depend on the strength of the transcriptional and translational promoters used. In addition, the magnitude of the immune response may depend on the level of protein expression and on the immunogenicity of the expressed gene product. In general, effective dose ranges of about 1 ng to 5 mg, 100 ng to 2.5 mg, 1 .mu.g to 750 .mu.g, and preferably about 10 .mu.g to 300 .mu.g of DNA is administered directly into muscle tissue. Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also suitable. It is also contemplated that booster vaccinations may be provided. Following vaccination with a polynucleotide immunogen, boosting with protein immunogens such as the Cpa1 or Cpa49 gene product is also contemplated.

The polynucleotide may be "naked", that is, unassociated with any proteins, adjuvants or other agents which affect the recipient's immune system. In this case, it is desirable for the polynucleotide to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline. Alternatively, the DNA may be associated with liposomes, such as lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture, or the DNA may be associated with an adjuvant known in the art to boost immune responses, such as a protein or other carrier. Agents which assist in the cellular uptake of DNA, such as, but not limited to, calcium ions, may also be used. These agents are generally referred to herein as transfection facilitating reagents and pharmaceutically acceptable carriers. Techniques for coating microprojectiles coated with polynucleotide are known in the art and are also useful in connection with this invention. For DNA intended for human use it may be useful to have the final DNA product in a pharmaceutically acceptable carrier or buffer solution. Pharmaceutically acceptable carriers or buffer solutions are known in the art and include those described in a variety of texts such as Remington's Pharmaceutical Sciences.

It is recognized by those skilled in the art that an optimal dosing schedule for a DNA vaccination regimen may include as many as five to six, but preferably three to five, or even more preferably one to three administrations of the immunizing entity given at intervals of as few as two to four weeks, to as long as five to ten years, or occasionally at even longer intervals.

Suitable methods of administration of any pharmaceutical composition disclosed in this application include, but are not limited to, topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal and intradermal administration.

For topical administration, the composition is formulated in the form of an ointment, cream, gel, lotion, drops (such as eye drops and ear drops), or solution (such as mouthwash). Wound or surgical dressings, sutures and aerosols may be impregnated with the composition. The composition may contain conventional additives, such as preservatives, solvents to promote penetration, and emollients. Topical formulations may also contain conventional carriers such as cream or ointment bases, ethanol, or oleyl alcohol.

In a preferred embodiment, a vaccine is packaged in a single dosage for immunization by parenteral (i.e., intramuscular, intradermal or subcutaneous) administration or nasopharyngeal (i.e., intranasal) administration. The vaccine is most preferably injected intramuscularly into the deltoid muscle. The vaccine is preferably combined with a pharmaceutically acceptable carrier to facilitate administration. The carrier is usually water or a buffered saline, with or without a preservative. The vaccine may be lyophilized for resuspension at the time of administration or in solution.

Microencapsulation of the protein will give a controlled release. A number of factors contribute to the selection of a particular polymer for microencapsulation. The reproducibility of polymer synthesis and the microencapsulation process, the cost of the microencapsulation materials and process, the toxicological profile, the requirements for variable release kinetics and the physicochemical compatibility of the polymer and the antigens are all factors that must be considered. Examples of useful polymers are polycarbonates, polyesters, polyurethanes, polyorthoesters, polyamides, poly (D,L-lactide-co-glycolide) (PLGA) and other biodegradable polymers. The use of PLGA for the controlled release of antigen is reviewed by Eldridge et al., CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY, 146:59-66 (1989).

The preferred dose for human administration is from 0.01 mg/kg to 10 mg/kg, preferably approximately 1 mg/kg. Based on this range, equivalent dosages for heavier body weights can be determined. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual. The vaccine may additionally contain stabilizers or pharmaceutically acceptable preservatives, such as thimerosal (ethyl(2-mercaptobenzoate-S)mercury sodium salt) (Sigma Chemical Company, St. Louis, Mo.).

When labeled with a detectable biomolecule or chemical, the collagen-binding proteins described herein are useful for purposes such as in vivo and in vitro diagnosis of streptococcal infections or detection of group A streptococcal bacteria. Laboratory research may also be facilitated through use of such protein-label conjugates. Various types of labels and methods of conjugating the labels to the proteins are well known to those skilled in the art. Several specific labels are set forth below. The labels are particularly useful when conjugated to a protein such as an antibody or receptor. For example, the protein can be conjugated to a radiolabel such as, but not restricted to, 32 P, 3 H, 14 C, 36 S, 125 I, or 131 I. Detection of a label can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography.

Bioluminescent labels, such as derivatives of firefly luciferin, are also useful. The bioluminescent substance is covalently bound to the protein by conventional methods, and the labeled protein is detected when an enzyme, such as luciferase, catalyzes a reaction with ATP causing the bioluminescent molecule to emit photons of light. Fluorogens may also be used to label proteins. Examples of fluorogens include fluorescein and derivatives, phycoerythrin, allo-phycocyanin, phycocyanin, rhodamine, and Texas Red. The fluorogens are generally detected by a fluorescence detector.

The protein can alternatively be labeled with a chromogen to provide an enzyme or affinity label. For example, the protein can be biotinylated so that it can be utilized in a biotin-avidin reaction, which may also be coupled to a label such as an enzyme or fluorogen. For example, the protein can be labeled with peroxidase, alkaline phosphatase or other enzymes giving a chromogenic or fluorogenic reaction upon addition of substrate. Additives such as 5-amino-2,3-dihydro-1,4-phthalazinedione (also known as Luminol.RTM.) (Sigma Chemical Company, St. Louis, Mo.) and rate enhancers such as p-hydroxybiphenyl (also known as p-phenylphenol) (Sigma Chemical Company, St. Louis, Mo.) can be used to amplify enzymes such as horseradish peroxidase through a luminescent reaction; and luminogeneic or fluorogenic dioxetane derivatives of enzyme substrates can also be used. Such labels can be detected using enzyme-linked immunoassays (ELISA) or by detecting a color change with the aid of a spectrophotometer. In addition, proteins may be labeled with colloidal gold for use in immunoelectron microscopy in accordance with methods well known to those skilled in the art.

The location of a ligand in cells can be determined by labeling an antibody as described above and detecting the label in accordance with methods well known to those skilled in the art, such as immunofluorescence microscopy using procedures such as those described by Warren and Nelson (Mol. Cell. Biol., 7: 1326-1337, 1987).

In addition to the therapeutic compositions and methods described above, the Cpa1 and Cpa49 proteins or active portions or fragments thereof, nucleic acid molecules or antibodies are useful for interfering with the initial physical interaction between a pathogen and mammalian host responsible for infection, such as the adhesion of bacteria, to mammalian extracellular matrix proteins such as collagen on in-dwelling devices or to extracellular matrix proteins in wounds; to block Cpa1 or Cpa49 protein-mediated mammalian cell invasion; to block bacterial adhesion between collagen and bacterial Cpa1 or Cpa49 proteins or portions thereof that mediate tissue damage; and, to block the normal progression of pathogenesis in infections initiated other than by the implantation of in-dwelling devices or surgical techniques.

The Cpa1 or Cpa49 proteins, or active fragments thereof, are useful in a method for screening compounds to identify compounds that inhibit collagen binding of streptococci to host molecules. In accordance with the method, the compound of interest is combined with one or more of the Cpa1 or Cpa49 proteins or fragments thereof and the degree of binding of the protein to collagen or other extracellular matrix proteins is measured or observed. If the presence of the compound results in the inhibition of protein-collagen binding, for example, then the compound may be useful for inhibiting group A streptococci in vivo or in vitro. The method could similarly be used to identify compounds that promote interactions of GAS with host molecules. The method is particularly useful for identifying compounds having bacteriostatic or bacteriocidal properties.

For example, to screen for GAS agonists or antagonists, a synthetic reaction mixture, a cellular compartment (such as a membrane, cell envelope or cell wall) containing one or more of the Cpa1 or Cpa49 proteins or fragments thereof and a labeled substrate or ligand of the protein is incubated in the absence or the presence of a compound under investigation. The ability of the compound to agonize or antagonize the protein is shown by a decrease in the binding of the labeled ligand or decreased production of substrate product. Compounds that bind well and increase the rate of product formation from substrate are agonists. Detection of the rate or level of production of product from substrate may be enhanced by use of a reporter system, such as a colorimetric labeled substrate converted to product, a reporter gene that is responsive to changes in Cpa1 or Cpa49 nucleic acid or protein activity, and binding assays known to those skilled in the art. Competitive inhibition assays can also be used.

Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to Cpa1 or Cpa49 nucleic acid molecules or proteins or portions thereof and thereby inhibit their activity or bind to a binding molecule (such as collagen to prevent the binding of the Cpa1 or Cpa49 nucleic acid molecules or proteins to its ligand. For example, a compound that inhibits Cpa1 or Cpa49 activity may be a small molecule that binds to and occupies the binding site of the Cpa1 or Cpa49 protein, thereby preventing binding to cellular binding molecules, to prevent normal biological activity. Examples of small molecules include, but are not limited to, small organic molecule, peptides or peptide-like molecules. Other potential antagonists include antisense molecules. Preferred antagonists include compounds related to and variants or derivatives of the Cpa1 or Cpa49 proteins or portions thereof. The nucleic acid molecules described herein may also be used to screen compounds for antibacterial activity.

The invention further contemplates a kit containing one or more Cpa1 or Cpa49-specific nucleic acid probes, which can be used for the detection of collagen-binding proteins from group A streptococci in a sample, or for the diagnosis of GAS bacterial infections. Such a kit can also contain the appropriate reagents for hybridizing the probe to the sample and detecting bound probe. In an alternative embodiment, the kit contains antibodies specific to either or both Cpa1 and Cpa49 proteins or active portions thereof which can be used for the detection of group A streptococci.

In yet another embodiment, the kit contains either or both the Cpa1 and Cpa49 proteins, or active fragments thereof, which can be used for the detection of GAS bacteria or for the presence of antibodies to collagen-binding GAS proteins in a sample. The kits described herein may additionally contain equipment for safely obtaining the sample, a vessel for containing the reagents, a timing means, a buffer for diluting the sample, and a colorimeter, reflectometer, or standard against which a color change may be measured.

In a preferred embodiment, the reagents, including the protein or antibody, are lyophilized, most preferably in a single vessel. Addition of aqueous sample to the vessel results in solubilization of the lyophilized reagents, causing them to react. Most preferably, the reagents are sequentially lyophilized in a single container, in accordance with methods well known to those skilled in the art that minimize reaction by the reagents prior to addition of the sample.

                             TABLE 1
                 Sequence homologies of the ORFs
                  of the GAS nra genomic region.
    GAS ORF
    (provi-
    visional)
    number/   Homologous                     Percentage
    desig-    protein sequence:              identity/
    nation    source organism                similarity Reference
    1         Multiple sugar                 34/59     Russell
    (msmRL)   metabolism regulator;                    et al.
              Streptococcus mutans                     (1992)
    2 (ORF2)  No homologous                  --        --
              sequence identified
    3         C-terminus of electron transfer 27/47     Chen and
    (etfl SL) flavoprotein 1a;                         Swanson
              Methylophilus methylotrophus             (1994)
    4 (epAL)  Signal peptidase I;            46/67     Cregg
              Staphylococcus aureus                    et al.
                                                       (1996)
    cpa       Protein F;                     28/41     Hanski
              Steptococcus pyogenes                    and
                                                       Caparon
                                                       (1992)
    nra       RofA regulator of protein F;   63/73     Fogg et al.
              Steptococcus pyogenes                    (1994)
    5 (ORF5)  Hypothetical 31.8 kDa protein  35/62     Ogasa-
              in hsH-cysK intergenic region;           wara et al.
              Bacillus subtilis                        (1994)
    6 (nitR3L) Nitrogenase regulator;         32/46     Machado
              Azospirillum brasilense                  et al.
                                                       (1995)
              Hypothetical 37.1 kDa protein; 59/75     Ogasa-
              Bacillus subtilis                        wara et al.
                                                       (1994)
    7 (kinL)  dA/dG-kinasel;                 57/74     Ma et al.
              Lactobacilus acidophilus                 (1995)
    8 (ssbL)  Single-strand DNA-binding protein; 50/65     Rikke
              Bacillus subtilis                        et al.
                                                       (1995)
    9 (phe7L) Phenylalanyl-tRNA              49/62     Brakhage
              synthase beta subunit;                   et al.
              Bacillus subtilis                        (1990)
                         TABLE 2
               Presence of nral rol/A(-associated)
             genes in selected GAS serotype strains.
                      Regulatory genes      Structural genes
        Serotype strain    nra    rofA     prtF     prtF2    cpa
        M1                -       +        -        -       +
        M2                -       +        -        -       -
        M3                +       +        +        -       -
        M4                +       +        -        +       -
        M5                +       +        -        +       -
        M6                -       +        +        -       -
        M12               -       +        +        +       -
        M18               +       +        -        +       -
        M24               -       +        +        -       -
        M49               +       -        -        +       +
    Genes were detected with specific probes used for genomic Southern blot
     hybridizations as well as by specific PCR assays. Sequences of primers
     used for analytical PCRs or to generate probes are shown in Table 4.
    + hybridization/PCR product detectable; - no hybridization/PCR product
     detectable.
                         TABLE 3
                   Human matrix protein-binding
              activity of a recombinent Cpa protein.
                    Collagen    Fibronectin   Laminin   BSA
        Cps/Mal     0.373 .+-.  0.074 .+-.    0.115 .+-. 0.049 .+-.
        fusion      0.011       0.006         0.036     0.021
        Mal         0.104 .+-.  0.042 .+-.    0.060 .+-. 0.033 .+-.
                    0.007       0.002         0.006     0.005
        HRPO        0.049 .+-.  0.038 .+-.    0.038 .+-. 0.028 .+-.
        (negative   0.013       0.015         0.012     0.006
        control)
    The binding activity of a purified Cpa-maltose binding protein fusion and
     the maltose-binding protein alone (Mal), both coupled to horseradish
     peroxidase (HRPO), were compared with that of HRPO alone. The assay was
     performed in an ELISA format as described in Experimental procedures. The
     results were read as OD.sub.482 values. The data were analysed by the
     Wilcoxon range test, and the binding of the Cpa-Mal fusion to collagen
     type I and to laminin was found to be statistically
        # significant (P < 0.05).
                                             TABLE 4
                               List of oligonucleotides used in this work.
                                                         Sequence
     Position
    Designation       Sequence (5' to 3')                ID. No.
     Numbers       Reference
    A.
    nra FOR           ATTTTTTCTCATGTTGCTA                SEQ ID NO:6
     6474-6492     This study
    nra REV           GTTTAGAATGGTTTAATTG                SEQ ID NO:7
     7308-7290     This study
    rofA FOR          GCCAATAACTGAGGTAGC                 SEQ ID NO:8
     141-158       Fogg et al. (1994)
    rofA REV          GGCTTTTGCTCTTTTAGGT                SEQ ID NO:9
     995-977       Fogg et al. (1994)
    cpa FOR           AGTTCACAAGTTGTCTACTG               SEQ ID NO:10
     3435-3454     This study
    cpa REV           AAATAATAGATAGCAAGCTG               SEQ ID NO:11
     3727-3708     This study
    prtF FOR          ATTAATGCCAGAGTTAGATG               SEQ ID NO:12
     1414-1433     Hanski and Caparon
            (1992)
    prtF REV          CGATTCTCTTCCACTTTG                 SEQ ID NO:13
     2259-2242     Hanski and Caparon
            (1992)
    prtF2 FOR         TACTCTGTTAAAGAAGTAACTG             SEQ ID NO:14
     2260-2281     Jaffe et al. (1996)
    prtF2 REV         CTCAGAGTCACTTTCTGG                 SEQ ID NO:15
     3168-3151     Jaffe et al. (1996)
    nifR3 FOR         GGATTTTGCCTACTACTTA                SEQ ID NO:16
     8443-8461     This study
    nifR3 REV         GTGGAATATCTAAAACAGAC               SEQ ID NO:17
     9313-9294     This study
    B.
    nra-ins FOR       TTTTATTGGAGACTAGAAGTTTA            SEQ ID NO:18
     6325-6347     This study
    nra-ins REV       AGCAAGCCACTGATTTAC                 SEQ ID NO:19
     7481-7464     This study
    cpa-ins FOR       TGCAAAAGAGGGATAAAAC                SEQ ID NO:20
     5932-5914     This study
    cpa-ins REV       GAAGCAGTAGACAACTTGTG               SEQ ID NO:21
     4707-4726     This study
    nraLuc FOR1       TAAACTAAAGTAGCTTAGCA               SEQ ID NO:22
     5953-5972     This study
    nraLuc FOR5       ATGGAACGTCATCACAAC                 SEQ ID NO:23
     6688-6705     This study
    nraLuc REV1       CAGATACCTAAAAATAAACG               SEQ ID NO:24
     7930-7911     This study
    cpa-pMAL FOR      GCTGAAGAACAATCAGTACCA              SEQ ID NO:25
     5798-5778     This study
    cpa-pMAL REV      TTAGTCATTTTTTAACCCTTTACG           SEQ ID NO:26
     3705-3728     This study
    C.
    RT-nra FOR        CTTTTTACTTATTAAGAGATGA             SEQ ID NO:27
     7669-7690     This study
    RT-nra REV        CTCGTTTAGAAAATCTTG                 SEQ ID NO:28
     7886-7869     This study
    RT-orf5 FOR       AAAATAATTAAATCAATAGCA              SEQ ID NO:29
     8030-8050     This study
    RT-orf5 REV       CCACAGAGATAATGTGT                  SEQ ID NO:30
     8258-8241     This study
    Oligonucleotides were used as primers to PCR amplify probes for Southern
     and Northern blot hybridizations (A), genomic
    Fragments for cloning into pFW11, pFW11-luc or pMAL-c2 plasmids (B) and
     primers for RT-PCR to detect nra and orf5-specific transcripts (C).
    Primer pairs nra-ins FOR/REV, cpa-ins FOR/REV, nraLuc FOR/REV and cpa-pMAL
     FOR/REV were 5' extended with Sphl/Spel. Nhel/BamHI and BAMHI/Pstl sites,
     respectively, to facilitate forced cloning of the resulting PCR products.
     The nucleotide position numbers refer to the GAS nra genomic sequence as
     submitted to GenBank or the cited publications.


Claim 1 of 9 Claims

What is claimed is:

1. An isolated nucleic acid molecule encoding the amino acid sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:4.




____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]