|
|
|
|
|
|
Title: Inhibition of HIV replication using soluble Tat peptide analogs United States Patent: 6,686,333 Issued: February 3, 2004 Inventors: Kashanchi; Fatah (Montclair, NJ); Sadaie; Mohammad Reza (Germantown, MD); Brady; John (Gaithersburg, MD) Assignee: The United States of America as represented by the Department of Health and (Washington, DC) Appl. No.: 269991 Filed: September 7, 1999 PCT Filed: October 2, 1997 PCT NO: PCT/US97/17704 PCT PUB.NO.: WO98/14587 PCT PUB. Date: April 9, 1998 Abstract Methods and compositions for inhibiting replication of HIV in a mammalian cell. The compositions can be a peptide, or a nucleic acids encoding a peptide, which inhibits transactivation of the HIV long terminal repeat. SUMMARY OF THE INVENTION In one aspect, the present invention relates to an isolated transdominant soluble Tat peptide. The transdominant soluble Tat peptide comprises a transdominant peptide sequence Cys-Phe-Xaa39 -Xaa40 -Xaa41 -Gly-Leu-Gly-Ile-Ser-Xaa47 -Gly-Xaa49 -Lys (SEQ ID NO:1), wherein Xaa39 is an amino acid residue selected from the group consisting of: Leu, Met, Ile, Thr, Gln, and Val; Xaa40 is an amino acid residue selected from the group consisting of: Thr, Arg, Lys, and Asn; Xaa41 is an amino acid residue exclusive of Lys; Xaa47 is an amino acid residue selected from the group consisting of: Tyr and His; Xaa49 is an amino acid residue selected from the group consisting of: Arg and Lys. The transdominant peptide sequence comprises an amino acid residue substitution at a position selected from the group consisting of: 44, 46, 47, and combinations thereof. Additionally, the transdominant soluble Tat peptide lacks an intact amino-terminal domain or an intact cysteine-rich domain. In some embodiments, the transdominant peptide sequence comprises a single amino acid residue substitution at position 44. In other embodiments, the transdominant peptide sequence comprises a single amino acid residue substitution at position 46 or 47. Generally, the transdominant soluble Tat peptide is no longer than 25 amino acid residues in length. In preferred embodiments, the amino acid at position 44 is an alanine residue. Typically, the transdominant peptide sequence is substituted only at position 44. In another aspect, the present invention relates to an isolated nucleic acid sequence encoding a transdominant soluble Tat peptide. The transdominant soluble Tat peptide comprises a transdominant peptide sequence having the sequence Cys-Phe-Xaa39 -Xaa40 -Xaa41 -Gly-Leu-Gly-Ile-Ser-Xaa47 -Gly-Xaa49 -Lys (SEQ ID NO:1), wherein Xaa39 is an amino acid residue selected from the group consisting of: Leu, Met, Ile, Thr, Gln, and Val; Xaa40 is an amino acid residue selected from the group consisting of: Thr, Arg, Lys, and Asn; Xaa41 is an amino acid residue exclusive of Lys; Xaa47 is an amino acid residue selected from the group consisting of: Tyr and His; Xaa49 is an amino acid residue selected from the group consisting of: Arg and Lys. The transdominant peptide sequence comprises an amino acid residue substitution at a position selected from the group consisting of: 44, 46, 47, and combinations thereof. Additionally, the transdominant soluble Tat peptide lacks an intact amino-terminal domain or an intact cysteine-rich domain. In a further aspect, the present invention is directed to an expression vector. The expression vector comprises a nucleic acid encoding a transdominant soluble Tat peptide comprising a transdominant peptide sequence having the sequence Cys-Phe-Xaa39 -Xaa40 -Xaa41 -Gly-Leu-Gly-Ile-Ser-Xaa47 -Gly-Xaa49 -Lys (SEQ ID NO:1), wherein Xaa39 is an amino acid residue selected from the group consisting of: Leu, Met, Iie, Thr, Gln, and Val; Xaa40 is an amino acid residue selected from the group consisting of: Thr, Arg, Lys, and Asn; Xaa41 is an amino acid residue exclusive of Lys; Xaa47 is an amino acid residue selected from the group consisting of: Tyr and His; Xaa49 is an amino acid residue selected from the group consisting of: Arg and Lys. The transdominant peptide sequence comprises an amino acid residue substitution at a position selected from the group consisting of: 44, 46, 47, and combinations thereof. Additionally, the transdominant soluble Tat peptide lacks an intact amino-terminal domain or an intact cysteine-rich domain. In an additional aspect, the present invention relates to a method of inhibiting HIV replication in a mammalian cell. The method comprises administering a therapeutically effective amount of a transdominant soluble Tat peptide to a mammalian cell. The Tat peptide comprises a nucleic acid encoding a transdominant peptide sequence having the sequence Cys-Phe-Xaa39 -Xaa40 -Xaa41 -Gly-Leu-Gly-Ile-Ser-Xaa47 -Gly-Xaa49 -Lys (SEQ ID NO:1), wherein Xaa39 is an amino acid residue selected from the group consisting of: Leu, Met, Ile, Thr, Gin, and Val; Xaa40 is an amino acid residue selected from the group consisting of: Thr, Arg, Lys, and Asn; Xaa41, is an amino acid residue exclusive of Lys; Xaa47 is an amino acid residue selected from the group consisting of: Tyr and His; Xaa49 is an amino acid residue selected from the group consisting of: Arg and Lys. The transdominant peptide sequence comprises an amino acid residue substitution at a position selected from the group consisting of: 44, 46, 47, and combinations thereof. Additionally, the transdominant soluble Tat peptide lacks an intact amino-terminal domain or an intact cysteine-rich domain. In some embodiments, the transdominant peptide sequence comprises a single amino acid residue substitution at position 44. In other embodiments, the transdominant peptide sequence comprises a single amino acid residue substitution at position 46 or 47. Generally, the transdominant soluble Tat peptide is no longer than 25 amino acid residues in length. In preferred embodiments, the amino acid at position 44 is an alanine residue. Typically, the transdominant peptide sequence is substituted only at position 44. In some embodiments, the therapeutically effective dose is administered ex vivo, in others the therapeutically effective dose is administered in vivo. Preferably, the mammalian cell is a human cell. In some embodiments, administration of the therapeutically effective dose of the transdominant soluble Tat peptide comprises expressing in the cell an isolated nucleic acid encoding the soluble transdominant Tat peptide. In other embodiments, the transdominant soluble Tat peptide is itself administered. Compositions and methods of the present invention have utility as therapeutic or prophylactic agent in inhibiting HIV replication. Various embodiments of this and other aspects of the invention can be had by reference to the specification as a whole. DETAILED DESCRIPTION OF THE INVENTION The present invention provides compositions and methods for inhibiting replication of HIV in vivo. Quite unexpectedly, it has been found that soluble Tat peptides having a core domain, but lacking the amino-terminal domain and/or cysteine-rich domain have the inhibitory transdominant phenotype when substitutions are made at positions 41, and 44, 46, or 47. Thus, contrary to the weight of opinion, core domain peptides lacking either the amino-terminal domain and/or cysteine rich domain can be altered to yield peptides with the transdominant phenotype. These soluble Tat peptides have pharmaceutical utility as a means to control replication of HIV in vivo or ex vivo. The soluble Tat peptides also have utility in regulating translation of cloned mRNA comprising a TAR sequence. Thus, the peptide can be used to control synthesis of desired proteins in eukaryotic expression systems. Transdominant Soluble Tat Peptides Transdominant soluble Tat peptides of the present invention are N amino acid residues in length, where N is any of the integers selected from the group consisting of from 12 to 300. Generally, transdominant soluble Tat peptides are less than 300 amino acids in length, typically less than 200 amino acids in length, preferably, less than 100 or 50 amino acids in length, more preferably less than 40, 30, or 25 amino acids in length, and most preferably less than 20 amino acids but at least 14 amino acids in length. The transdominant soluble Tat peptide comprises a transdominant Tat peptide sequence. The transdominant Tat peptide sequence includes the sequence: Cys-Phe-Xaa39 -Xaa40 -Xaa41 -Gly-Leu-Gly-Ile-Ser-Xaa47 -Gly-Xaa49 -Lys (SEQ ID NO:1). In the transdominant Tat peptide sequence Xaa39 is an amino acid residue selected from the group consisting of: Leu, Met, Ile, Thr, Gln, and Val; Xaa40 is an amino acid residue selected from the group consisting of: Thr, Arg, Lys, and Asn; Xaa41 is an amino acid residue exclusive of Lys; Xaa47 is an amino acid residue selected from the group consisting of: Tyr and His; Xaa49 is an amino acid residue selected from the group consisting of: Arg and Lys. Numbering of the amino acids is per the numbering of the HIV-1 Tat protein as disclosed in Pearson et al, Proc. Natl. Acad. Sci. USA, 87:5079-5083 (1990); Frankel et al., Proc. Natl. Acad.Sci. USA 86:7397-7401 (1989), both of which are incorporated herein by reference, where the amino terminal methionine is numbered as position 1 and the carboxyl terminal residue is position 86. Thus, the transdominant peptide sequence extending from cysteine to lysine, supra, extends from amino acid residue 37 through 50. The sequences of HIV-1 Tat protein variants and the consensus sequences of subtypes of the HIV-1 Tat protein can be had by reference to the HIV Sequence Database, T-10, MS K710, (Los Alamos, N.Mex. 87545), incorporated herein by reference. The following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). See also, Creighton (1984) Proteins W.H. Freeman and Company. In preferred embodiments, the amino acid residue at position 41 is not a conservative substitution for lysine. In particularly preferred embodiments, the amino acid residue at position 41 is an alanine. In other embodiments, the transdominant peptide sequence comprises an amino acid residue at the amino terminal and preceding amino acid residue 37 (i.e., at position 36), wherein amino acid residue 36 is selected from the group consisting of: Leu, Val, Ala, Asn, Met, Trp, and Tyr. The transdominant peptide sequence comprises an amino acid residue substitution at a position selected from the group consisting of: 44, 46, 47, and combinations thereof. The amino acid residue substituted at positions 44, 46, or 47 can be selected from any amino acid other than the one specified in the wild-type Tat sequence for that position. Thus, any of the natural amino acids or analogs thereof which differ from the amino acid residues present at position 44 (Gly), 46 (Ser), or 47 (Tyr or His) can be substituted therefor. In preferred embodiments, the substitution is at position 44. In particularly preferred embodiments, the substitution at position 44 is a serine; the substitution at position 46 or 47 is an alanine. The amino acids referred to herein are described by shorthand designations as follows: TABLE I
Amino Acid Nomenclature
Name 3-letter 1 letter
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic Acid Asp D
Cysteine Cys C
Glutamic Acid Glu E
Glutamine Gln Q
Glycine Gly G
Histidine His H
Homoserine Hse --
Isoleucine Ile I
Leucine Leu L
Lysine Lys K
Methionine Met M
Methionine sulfoxide Met (O) --
Methionine Met (S-Me) --
methylsulfonium
Norleucine Nle --
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
Tryptophan Trp w
Tyrosine Tyr Y
Valine Val V
Generally, the transdominant peptide sequence will be less than 35 amino acid residues in length, typically less than 30, preferably less than 25, and most preferably less than 20 amino acid residues in length. Those of skill in the art will readily understand that the amino acid sequence which makes up the transdominant soluble Tat peptide and which is linked to the transdominant peptide sequence (i.e., the "non-transdominant peptide sequence") will be incapable of transactivating the HIV LTR (long terminal repeat). By "incapable of transactivating the HIV LTR" is meant that the non-transdominant peptide sequence component of the transdominant soluble Tat peptide will not increase transactivation by more than 20% relative to a control lacking the non-transdominant peptide sequence. Furthermore, the non-transdominant peptide sequence generally should not substantially interfere in the transdominant phenotype provided by the transdominant peptide sequence. Thus, for example, specific or non-specific binding to cellular components to a degree which prevents functioning of the transdominant peptide sequence should be avoided. Usually, the non-transdominant peptide sequence should not substantially reduce cell viability (e.g., increase cell doubling time by more than 10%). Preferably, the transdominant soluble Tat peptide is soluble in an aqueous solution. Within any of the up to 70 amino acid residues contiguous and extending toward the amino terminal end from amino acid residue 37 of the transdominant peptide sequence, an intact amino-terminal domain and/or an intact cysteine-rich domain is lacking, with one proviso. The proviso is that an amino-terminal domain is directly adjacent and at the amino-terminal end of the cysteine-rich domain. Thus, a construct in which the amino-terminal domain and the cysteine-rich domain are situated so they no longer function to transactivate an HIV LTR when fused to, for example, a Tat protein sequence from 37 through 86, is within the scope of the present invention. Typically, the transdominant peptide sequence lacks an intact amino-terminal domain lying between the amino acids which precede amino acid residue 37 (cysteine) of the transdominant peptide sequence by between 10 and 50 amino acids; more preferably between 16 and 40, most preferably between 16 and 36. Alternatively, or additionally, the transdominant peptide sequence lacks an intact cysteine-rich domain lying within the amino acid residues within 30 amino acid residues contiguous to and preceding the transdominant peptide sequence (e.g., amino acid residue 37). Preferably, a cysteine-rich domain is absent within the 20 amino acids contiguous to residue 37 of the transdominant peptide sequence. More preferably, a cysteine-rich domain is absent within the 16 amino acids contiguous to residue 37 of the transdominant peptide sequence. Most preferably, the cysteine-rich domain does not overlap the transdominant peptide sequence at amino acid 37 or reside within the preceding 15 contiguous amino acids from amino acid 37. The presence of an amino-terminal domain or a cysteine-rich domain can be identified using expression cassettes in which all of the up to 70 amino acids contiguous and proximal to amino acid residue 36 (inclusive) of the transdominant soluble Tat peptide are fused to amino acids 37 to 86 of a wild-type HIV-1 Tat protein. Transfection and CAT assays for transactivation of the HIV-1 LTR can be determined using methods known to those of skill in the art and as disclosed herein at Example 1. See, also, Kashanchi et al., J. Virol, 68(5):3298-3307 (1994); Pearson et al., Proc. Natl. Acad. Sci. USA, 87:5079-5083 (1990); Frankel et al., Proc. Natl Acad. Sci. USA 86:7397-7401 (1989). The fusion protein which lacks either an amino-terminal domain, a cysteine-rich domain, or both, will transactivate the HIV-LTR by less than 20% relative to the wild-type HIV-1 Tat protein control, preferably by less than 15%, more preferably by less than 10%, and most preferably by less than 5%. Nucleic Acids Encoding Transdominant Soluble Tat Peptides The present invention provides isolated nucleic acids encoding each of the transdominant soluble Tat peptides of the present invention as described more fully, supra. The isolated nucleic acids encoding transdominant soluble Tat peptides can be RNA, DNA, or chimeras thereof. Nucleic acids encoding transdominant soluble Tat peptides can be made using standard recombinant or synthetic techniques. With the amino acid sequences of the transdominant soluble Tat peptides herein provided, one of skill can readily construct a variety of clones containing functionally equivalent nucleic acids, such as nucleic acids which differ in sequence but which encode the same peptides. Cloning methodologies to accomplish these ends, and sequencing methods to verify the sequence of nucleic acids are well known in the art. Examples of appropriate cloning and sequencing techniques, and instructions sufficient to direct persons of skill through many cloning exercises are found in Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Ed., Vols. 1-3, Cold Spring Harbor Laboratory (1989)), Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques (Berger and Kimmel (eds.), San Diego. Academic Press, Inc. (1987)), or Current Protocols in Molecular Biology, (Ausubel, et al. (eds.), Greene Publishing and Wiley-Interscience, New York (1987). Product information from manufacturers of biological reagents and experimental equipment also provide information useful in known biological methods. Such manufacturers include the SIGMA chemical company (Saint Louis, Mo.), R&D systems (Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway, N.J.), CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem Genes Corp., Aldrich Chemical Company (Milwaukee, Wis.), Glen Research, Inc., GIBCO BRL Life Technologies, Inc. (Gaithersburg, Md.), Fluka Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland), Invitrogen, San Diego, Calif., and Applied Biosystems (Foster City, Calif.), as well as many other commercial sources known to one of skill. The isolated nucleic acid compositions of this invention can also be synthesized in vitro. Deoxynucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981), Tetrahedron Letts., 22(20):1859-1862, e.g., using an automated synthesizer, e.g., as described in Needham-VanDevanter et al. (1984) Nucleic Acids Res., 12:6159-6168. Expression of Nucleic Acids Encoding a Transdominant Soluble Tat Peptide Once the isolated nucleic acids encoding an transdominant soluble Tat peptide of the present invention are constructed, one can express them in a recombinantly engineered cell such as bacteria, yeast, insect (especially employing baculoviral vectors), and mammalian cells. A "recombinant protein" is a protein produced using cells that do not have an endogenous copy of the DNA construct (e.g., a vector) which is able to express the protein. The cells produce the recombinant protein because they have been genetically altered by the introduction of the appropriate nucleic acid sequence. It is expected that those of skill in the art are knowledgeable in the numerous expression systems available for expression of DNA encoding transdominant soluble Tat peptides. No attempt to describe in detail the various methods known for the expression of proteins in prokaryotes or eukaryotes will be made. In brief summary, the expression of nucleic acids encoding transdominant soluble Tat peptides will typically be achieved by operably linking the DNA to a promoter (which is either constitutive or inducible), followed by incorporation into an expression vector. The vectors can be suitable for replication and integration in either prokaryotes or eukaryotes. Typical expression vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the DNA encoding the transdominant soluble Tat peptide. To obtain high level expression of a cloned gene, it is desirable to construct expression vectors which contain, at the minimum, a strong promoter to direct transcription, a ribosome binding site for translational initiation, and a transcription/translation terminator. Methods of expression in prokaryotes or eukaryotes are disclosed in, for example, Sambrook et al., Berger and Kimmel, and Ausubel et al., all supra. The transdominant soluble Tat peptides of this invention, recombinant or synthetic, can be purified to substantial purity by standard techniques well known in the art, including selective precipitation with such substances as ammonium sulfate, column chromatography, immunopurification methods, and others. See, for instance, R. Scopes, Protein Purification: Principles and Practice, Springer-Verlag: New York (1982); Deutscher, Guide to Protein Purification, Academic Press, 1990. For example, antibodies may be raised to the transdominant soluble Tat peptides as described herein. The protein may then be isolated from cells expressing the recombinant transdominant soluble Tat peptide and further purified by standard protein chemistry techniques. Methods of Inhibiting HIV Replication The present invention also provides methods of inhibiting HIV transcription or translation (i.e., HIV replication) in a mammalian cell, most preferably a primate cell such as macaques, chimpanzees, or human cells. The method comprises administering to a mammalian cell a therapeutically effective amount of a transdominant soluble Tat peptide of the present invention, wherein the therapeutically effective amount is sufficient to inhibit HIV replication. Administration of the transdominant soluble Tat peptide may be accomplished by administering the peptide itself to a mammalian cell, or by expression from a nucleic acid encoding a transdominant soluble Tat peptide of the present invention. Typically, the replication of HIV is inhibited by at least 20%, in some embodiments by at least 30%, more often at least 40%, generally, at least 50%, preferably at least 60%, more preferably at least 70%, and most preferably at least 80%. Preferably, the viral strain whose replication is inhibited is HIV-1, HIV-2, or SIV. Methods of assessing inhibition of HIV or SIV replication are known to those of ordinary skill in the art. See, e.g., Example 3; and, Kashanchi et al, J. Virol., 68(5):3298-3307 (1994). A. Pharmaceutical Compositions The transdominant soluble Tat peptides of the present invention can be administered by provision of the transdominant soluble Tat peptide itself, or by expression of a nucleic acid which encodes a transdominant soluble Tat peptide. Generally, a therapeutically effective amount of the transdominant Tat peptide is administered under physiological conditions. Physiological conditions are those which support cell viability and biosynthesis. Typically, physiological conditions also support the proliferation of cells. Thus, the term "physiological conditions" includes reference to conditions (e.g., temperature, osmolarity, pH) that are typical inside a living organism or a cell. While it is recognized that some organs are subject to extreme conditions, the intra-organismal and intra-cellular environment normally varies around pH 7 (i.e., from pH 6.0 to pH 8.0, more typically pH 6.5 to 7.5), contains water as the predominant solvent, and exists at a temperature above 0oC. and below 50oC. Osmolarity is within the range that is supportive of cell viability and proliferation. The transdominant soluble Tat peptides of the present invention, and nucleic acids encoding the transdominant soluble Tat peptides of the present invention are useful for parenteral, intravenous, topical, oral, or local administration, such as by aerosol or transdermally, for prophylactic and/or therapeutic treatment of a mammal, particularly a human. The pharmaceutical compositions can be administered in a variety of unit dosage forms depending upon the method of administration. The compositions containing the present transdominant soluble Tat peptides (or nucleic acids encoding them) can be administered for therapeutic or prophylactic treatments. In therapeutic applications, compositions are administered to a patient suffering from an HIV infection in an amount sufficient to at least partially arrest the disease and its complications. In prophylactic application, compositions are administered to a patient susceptible to an HIV infection in an amount sufficient to at least inhibit transcription from the HIV LTR, or inhibit translation of a TAR mRNA. An amount adequate to accomplish this is defined as a "therapeutically effective dose." Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's health. Means of assessing inhibition of HIV replication, transcription, and translation are known to those of skill in the art, and discussed, supra. Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of the peptides or nucleic acids of this invention to effectively treat the patient. Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400; (b.) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art. Peptide or nucleic acid compositions of the invention, alone or in combination with other suitable components, can be made into aerosol formulations (i.e., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. Suitable formulations for rectal administration include, for example, suppositories, which consist of the packaged nucleic acid with a suppository base. Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of the packaged nucleic acid with a base, including, for example, liquid triglycerides, polyethylene glycols, and paraffin hydrocarbons. Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. In the practice of this invention, compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally. Parenteral administration and intravenous administration are the preferred methods of administration. The formulations of nucleic acids or peptides of the invention can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transfected by the nucleic acid as described in the context of ex vivo therapy can also be administered intravenously or parenterally as described infra. Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, Pa. (1995). B. Administration of Transdominant Soluble Tat Peptides Methods of introducing peptides into cells are well known in the art. It is recognized that the transdominant soluble Tat peptides when administered orally, must be protected from digestion. This is typically accomplished either by complexing the peptide with a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the peptide in an appropriately resistant carrier such as a liposome, Means of protecting proteins from digestion are well known in the art. For example, numerous emulsion based systems have been proposed as pharmaceutical formulations for administration of peptides and proteins. In most cases, those emulsions may be characterized as water-in-oil microemulsions, which are thermodynamically stable and usually self-emulsifying; see Cho et al., WO 90/03164; Cho et al., WO 91/14454; Affinity, WO 92/18147; Riley, U.S. Pat. No. 5,055,303; Ritschel, Meth. Find. Exp. Clin. Pharmacol. 13:205-220 (1991). In each of these cases, the internal dispersed phase containing the protein typically is aqueous and the continuous phase typically is lipoidal. Other emulsions have been disclosed in the submicron size range which contain specific ingredients such as lysophosphatidylcholine (Yesair, WO 92/03121). Zerbe et al., WO 93/00076, disclose a drug delivery system consisting of a suspension of microparticles having a spherical core composed of a biopolymer, preferably a protein such as albumin or gelatin, which typically has been crosslinked or denatured to maintain its structural coherency. The spherical core can be combined with a bioadhesive polymer. Riley, U.S. Pat. No. 5,055,303, discloses a bioadherent emulsion of the water-in-hydrophobic phase type, wherein the continuous hydrophobic phase is a solid fat. U.S. Pat. No. 5,514,670 discloses emulsions which include submicron particles, a peptide, and an aqueous continuous phase that enhances oral bioavailability of the peptide. The aqueous continuous phase promotes absorption of the bioactive peptide through mucosal surfaces by achieving mucoadhesion of the emulsion particles. Other types of microparticulate drug delivery systems also have been proposed as suitable for oral administration of therapeutic proteins, such as microspheres (WO 93/00077), lipospheres (Domb, U.S. Pat. No. 5,188,837), microcapsules (EP 442671), liposomes (WO 91/05545), or other lipid vesicles (Yoshida et al., EP 140,085). See, also, WO 90/03164; WO 91/14454; WO 92/18147; U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028 4,957,735 and 5,019,369, 5,055,303; 5,514,670; 5,413,797; 5,268,164; 5,004,697; 4,902,505; 5,506,206, 5,271,961; 5,254,342 and 5,534,496, each of which is incorporated herein by reference. In preferred embodiments, the transdominant peptide sequence of the present invention is linked to a targeting ligand which provides selective binding to a desired cell receptor or allows transport into an anatomical site. Targeting ligands selective for T-cells are known in the art. Callebaut et al. (Virology, 218:181-192 (1996), incorporated herein by reference) teach template assembled synthetic peptides (TASP) in which a lysine-rich short peptide (KKKGPKEKGC (SEQ ID NO:10) or KKKKKGC (SEQ ID NO:11) was used as a template to covalently anchor arrays of tripeptides, such as RPR, RPK, or KPR, at the .epsilon.-amino groups of the lysine residues in the templates using Boc and Fmoc solid-phase methodology. The RP dipeptide present in these arrays is a highly conserved motif in the V3 loop of the extracellular envelope glycoprotein of different types of HIV isolates. This extracellular glycoprotein contains the binding site for the CD4 receptor. Pentavalent presentation of 5(RPR)-(SEQ ID NO:12) 5(RPK)-(SEQ ID NO:13), or 5(KPR)-(SEQ ID NO:14) TASP molecules were strongly inhibitory for HIV infection. A transdominant peptide sequence of the present invention can be linked internally, or at the amino or carboxy terminal end of one or more of the peptides in these pentavalent TASP structures to provide targeting to T-cells. In particularly preferred embodiments, one or more amino acids in the TASP molecule and/or in the transdominant peptide sequence are D-amino acid analogs. Additionally, reduced peptide bond analogs between the amino terminal and penultimate amino terminal amino acids of the TASP peptides and/or the transdominant soluble Tat peptide can be used to increase the anti-viral potency of the TASP-transdominant soluble Tat peptide conjugate. Reduced peptide bond analogs are known in the art and can be synthesized by reductive amination of N-Boc-.alpha.-amioaldehydes in dimethylformamide containing 1% acetic acid. Sasaki and Coy, Peptides, 8:119-121 (1987); Guichard et al., Pept. Res., 6:121-124 (1993), both of which are incorporated herein by reference. Linkage via peptide bonds or chemical crosslinkers is known in the art. Linker molecules are readily available from commercial sources (Pierce Chemical Company, Rockford Ill.). A "linker", as used herein, is a molecule that is used to join two molecules. The linker is capable of forming covalent bonds to both molecules. Suitable linkers are well known to those of skill in the art and include, but are not limited to, straight or branched-chain carbon linkers, heterocyclic carbon linkers, or peptide linkers. Where both molecules are polypeptides, the linkers may be joined to the constituent amino acids through their side groups (e.g., through a disulfide linkage to cysteine). Many procedures and linker molecules for attachment of various compounds including radionuclide metal chelates, toxins and drugs to proteins are known. See, for example,.European Patent Application No. 188,256; U.S. Pat. Nos. 4,671,958, 4,659,839, 4,414,148, 4,699,784; 4,680,338; 4,569,789; 4,589,071; and Borlinghaus et al. Cancer Res. 47: 4071-4075 (1987), which are incorporated herein by reference. In some circumstances, it is desirable to free the peptide of the present invention from the ligand when the chimeric molecule has reached its target site. Therefore, chimeric conjugates comprising linkages which are cleavable in the vicinity of the target site may be used when the effector is to be released at the target site. Cleaving of the linkage to release the agent from the ligand may be prompted by enzymatic activity or conditions to which the immunoconjugate is subjected either inside the target cell or in the vicinity of the target site. A number of different cleavable linkers are known to those of skill in the art. See U.S. Pat. Nos. 4,618,492; 4,542,225, and 4,625,014. The mechanisms for release of an agent from these linker groups include, for example, irradiation of a photolabile bond and acid-catalyzed hydrolysis. U.S. Pat. No. 4,671,958, for example, includes a description of immunoconjugates comprising linkers which are cleaved at the target site in vivo by the proteolytic enzymes of the patient's complement system. In view of the large number of methods that have been reported for attaching a variety of radiodiagnostic compounds, radiotherapeutic compounds, drugs, toxins, and other agents to antibodies, one skilled in the art will be able to determine a suitable method for attaching a given agent to an antibody or other protein. In other embodiments, a transdominant peptide sequence of the present invention is linked to a synthetic polymeric construct (SPC) which includes the consensus sequence of the HIV-1 surface envelope glycoprotein gp120 V3 loop (GPGRAF (SEQ ID NO.15)). See, Yahi et al., J. of Virology, 68(9):5714-5720 (1994). The SPC is a multibranched structure constructed using standard solid-phase synthetic methods. Briefly, peptide chains are elongated stepwise on 4-(oxy-methyl)-phenylacetamidomethyl resins by using t-butyloxycarbonyl-benzyl chemistry. Sabatier et al., Biochemistry, 32:2763-2770 (1993). The SPC is constructed using multimeric V3 loop consensus sequences linked to amino groups of lysine residues. For example, [GPGRAF]8 -SPC is a multibranched structure comprising eight GPGRAF (SEQ ID NO:15) sequences, with each of the GRGRAF (SEQ ID NO:15) dsequences linked to an amine group of lysine (K) in the multimeric structure: (K)4 -(K)2 -(K)-.beta.A. Multibranched (dendrimeric) structures are known in the art. The SPC typically includes at least six of the V3 loop consensus sequences, and preferably at least eight of the V3 loop consensus sequences, but less than 100 V3 loops, preferably less than 50, more preferably less than 25, and most preferably less than 15. The SPC may be linked to the transdominant peptide sequence at the carboxy terminal amino acid, amino terminal amino acid, or via an internal amino acid. Preferably, linkage is achieved via a peptide bond to the amino terminus of the transdominant peptide sequence. The compositions for administration will commonly comprise a solution of the transdominant soluble Tat peptide dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the patient's needs. Thus, a typical pharmaceutical composition for intravenous administration would be about 0.1 to 10 mg of peptide per patient per day. Dosages from 0.1 up to about 100 mg per patient per day may be used, particularly when the peptide composition is administered to a secluded site and not into the blood stream, such as into a body cavity or into a lumen of an organ. As will be readily understood by the clinician of ordinary skill in the art, the dose will be dependent upon the properties of the particular peptide employed, e.g., its activity and biological half-life, the concentration of peptide in the formulation, the site and rate of dosage, the clinical tolerance of the patient involved, the severity of the disease, and the like. C. Administration of Nucleic Acids Encoding Transdominant Soluble Tat Pep tides Cells can be transfected with a nucleic acid encoding a transdominant soluble Tat peptide of the present invention in vitro and in vivo. The term "transfected" includes reference to the introduction of a nucleic acid into a eukaryotic cell where the nucleic acid can be incorporated into the genome of the cell (i.e., chromosome, plasmid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA). A variety of methods for delivering and expressing a nucleic acid within a mammalian cell are known to those of ordinary skill in the art. Such methods include, for example liposome-based gene delivery (Debs and Zhu (1993) WO 93/24640; Mannino and Gould-Fogerite (1988) Bio Techniques 6(7): 682-691; Rose U.S. Pat No. 5,279,833; Brigham (1991) WO 91/06309; Felgner et al. (1987) Proc. Natl. Acad. Sci. USA 84: 7413-7414; and, Budker et al., Nature Biotechnology, 14(6):760-764 (1996)). Other methods known to the skilled artisan include electroporation (U.S. Pat. Nos. 5,545,130, 4,970,154, 5,098,843, and 5,128,257), direct gene transfer, cell fusion, precipitation methods, particle bombardment, and receptor-mediated uptake (U.S. Pat. Nos. 5,547,932, 5,525,503, 5,547,932, and 5,460,831). See also, U.S. Pat. No. 5,399,346. Following transfection of a nucleic acid encoding a transdominant soluble Tat peptide, a therapeutically effective amount of the peptide is expressed. Such genetic therapy procedures have been used to correct acquired and inherited genetic defects, cancer, and viral infection in a number of contexts. The ability to express artificial nucleic acids in humans facilitates the prevention and/or cure of many important human diseases, including many diseases which are not amenable to treatment by other therapies. As an example, in vivo expression of cholesterol-regulating genes, genes which selectively block the replication of HIV, and tumor-suppressing genes in human patients dramatically improves the treatment of heart disease, AIDS, and cancer, respectively. For a review of gene therapy procedures, see Anderson, Science (1992) 256:808-813; Nabel and Felgner (1993) TIBTECH 11: 211-217; Mitani and Caskey (1993) TIBTECH 11: 162-166; Mulligan (1993) Science 926-932; Dillon (1993) TIBTECH 11: 167-175; Miller (1992) Nature 357: 455-460; Van Brunt (1988) Biotechnology 6(10): 1149-1154; Vigne (1995) Restorative Neurology and Neuroscience 8: 35-36; Kremer and Perricaudet (1995) British Medical Bulletin 51(1) 31-44; Haddada et al. (1995) in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds) Springer-Verlag, Heidelberg Germany; and Yu et al., Gene Therapy (1994) 1:13-26. In preferred embodiments, a nucleic acid encoding a transdominant soluble Tat peptide of the present invention is operably linked to a promoter which is preferentially induced in HIV infected cells. Accordingly, introduction and induction of this promoter-nucleic acid construct in HIV infected cells directs expression of the nucleic acid encoding a transdominant soluble Tat peptide. Preferred promoters include the VA1 promoter (GenBank Accession No. M35961) from adenovirus, and the LTR promoter. The sequence of the VA1 and LTR promoters are well known in the art and provided below. VA1 Promoter 1 gggcactctt ccgtggtctg gtggataaat tcgcaagggt atcatggcgt ggacgaccgg 61 ggttcgaacc ccggatccgt gatccatgcg gttaccgtcc gccgcccgtg cgtcgaaccc 121 aggtgtgcga cgtcagacaa cgggggagcg ctcctt (SEQ ID NO:16). LTR Promoter TCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCG A GCCCTCAGATGCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCT GG AGACTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAG (SEQ ID NO:17). See, e.g., DNA Tumor Viruses, 2nd edition, Part II, Cold Spring Harbor (1980), John Tooze (Ed.); Kashanchi et al., J. of Virology, 68(5):3298-3307 (1994), both of which are incorporated herein by reference. Delivery of the gene or genetic material into the cell is the first critical step in gene therapy treatment of disease. A large number of delivery methods are well known to those of skill in the art. Such methods include, for example liposome-based gene delivery (Debs and Zhu (1993) WO 93/24640; Mannino and Gould-Fogerite (1988) Bio Techniques 6(7): 682-691; Rose U.S. Pat. No. 5,279,833; Brigham (1991) WO 91/06309; and Felger et al. (1987) Proc. Natl. Acad. Sci. USA 84: 7413-7414), and replication-defective retroviral vectors harboring a therapeutic polynucleotide sequence as part of the retroviral genome (see, e.g., Miller et al. (1990) Mol. Cell. Biol. 10:4239 (1990); Kolberg (1992) J. NIH Res. 4:43, and Cornetta et al. Hum. Gene Ther. 2:215 (1991)). Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof. See, e.g., Buchscher et al. (1992) J. Virol. 66(5) 2731-2739; Johann et al. (1992) J. Virol. 66 (5):1635-1640 (1992); Sommerfelt et al., (1990) Virol. 176:58-59; Wilson et al. (1989) J. Virol. 63:2374-2378; Miller et al., J. Virol. 65:2220-2224 (1991); Wong-Staal et al., PCT/US94/05700, and Rosenburg and Fauci (1993) in Fundamental Immunology, Third Edition Paul (ed) Raven Press, Ltd., New York and the references therein, and Yu et al., Gene Therapy (1994) supra). AAV-based vectors can be used to transfect cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and in in vivo and ex vivo gene therapy procedures. See, West et al. (1987) Virology 160:38-47; Carter et al. (1989) U.S. Pat. No. 4,797,368; Carter et al. WO 93/24641 (1993); Kotin (1994) Human Gene Therapy 5:793-801; Muzyczka (1994) J. Clin. Invst. 94:1351 and Samulski (supra) for an overview of AAV vectors. Construction of recombinant AAV vectors are described in a number of publications, including Lebkowski, U.S. Pat. No. 5,173,414; Tratschin et al. (1985) Mol. Cell. Biol. 5(11):3251-3260; Tratschin, et al. (1984) Mol. Cell. Biol., 4:2072-2081; Hermonat and Muzyczka (1984) Proc. Natl. Acad. Sci. USA, 81:6466-6470; McLaughlin et al. (1988) and Samulski et al. (1989) J. Virol., 63:03822-3828. Cell lines that can be transformed by rAAV include those described in Lebkowski et al. (1988) Mol. Cell. Biol., 8:3988-3996. 1. Ex vivo Transfection of Cells Ex vivo cell transfection for gene therapy (e.g., via re-infusion of the transformed cells into the host organism) is well known to those of skill in the art. In a preferred embodiment, cells are isolated from the subject organism, transfected with a nucleic acid encoding a transdominant soluble Tat peptide (alone or in a vector), and re-infused back into the subject organism (e.g., a human patient). Various cell types suitable for ex vivo transfection are well known to those of skill in the art (see, e.g., Freshney et al., Culture of Animal Cells, a Manual of Basic Technique, Third edition Wiley-Liss, New York (1994)) and the references cited therein for a discussion of how to isolate and culture cells from patients). The nucleic acid encoding a transdominant soluble Tat peptide is placed in a vector under the control of an activated or constitutive promoter, or under the control of an inducible promoter. The transfected cell(s) express a therapeutically effective amount of the peptide to inhibit replication of HIV, or to inhibit transcription or translation of HIV nucleic acids. In one particularly preferred embodiment, stem cells are used in ex-vivo procedures for cell transfection and gene therapy. The advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow. Methods for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN-.gamma. and TNF-.alpha. are known (see, Inaba et al. (1992) J. Exp. Med. 176, 1693-1702, and Szabolcs et al. (1995) 154: 5851-5861). Stem cells are isolated for transfection and differentiation using known methods. For example, in mice, bone marrow cells are isolated by sacrificing the mouse and cutting the leg bones with a pair of scissors. Stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and lad (differentiated antigen presenting cells). For an example of this protocol see, Inaba et al. (1992) J. Exp. Med. 176, 1693-1702. In humans, bone marrow aspirations from iliac crests are performed, e.g., under general anesthesia in the operating room. The bone marrow aspirations is approximately 1,000 ml in quantity and is collected from the posterior iliac bones and crests. If the total number of cells collected is less than about 2x108 /kg, a second aspiration using the sternum and anterior iliac crests in addition to posterior crests is performed. During the operation, two units of irradiated packed red cells are administered to replace the volume of marrow taken by the aspiration. Human hematopoietic progenitor and stem cells are characterized by the presence of a CD34 surface membrane antigen. This antigen is used for purification, e.g., on affinity columns which bind CD34. After the bone marrow is harvested, the mononuclear cells are separated from the other components by means of ficol gradient centrifugation. This is performed by a semi-automated method using a cell separator (e.g., a Baxter Fenwal CS3000+ or Terumo machine). The light density cells, composed mostly of mononuclear cells are collected and the cells are incubated in plastic flasks at 37oC. for 1.5 hours. The adherent cells (monocytes, macrophages and B-Cells) are discarded. The non-adherent cells are then collected and incubated with a monoclonal anti-CD34 antibody (e.g., the murine antibody 9C5) at 4oC. for 30 minutes with gentle rotation. The final concentration for the anti-CD34 antibody is 10 .mu.g/ml. After two washes, paramagnetic microspheres (Dyna Beads, supplied by Baxter Immunotherapy Group, Santa Ana, Calif.) coated with sheep antimouse IgG (Fc) antibody are added to the cell suspension at a ratio of 2 cells/bead. After a further incubation period of 30 minutes at 4oC., the rosetted cells with magnetic beads are collected with a magnet. Chymopapain (supplied by Baxter Immunotherapy Group, Santa Ana, Calif.) at a final concentration of 200 U/ml is added to release the beads from the CD34+ cells. Alternatively, and preferably, an affinity column isolation procedure can be used which binds to CD34, or to antibodies bound to CD34 (see, the examples below). See, Ho et al. (1995) Stem Cells 13 (suppl. 3): 100-105. See also, Brenner (1993) Journal of Hematotherapy 2: 7-17. In another embodiment, hematopoietic stem cells are isolated from fetal cord blood. Yu et al. (1995) Proc. Natl. Acad. Sci. USA, 92: 699-703 describe a method of transfecting CD34+ cells from human fetal cord blood using retroviral vectors. 2. In vivo Transfection Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.) containing nucleic acids encoding a transdominant soluble Tat peptide can be administered directly to the organism for transfection of cells in vivo, or a nucleic acid of the present invention can be transfected directly (i.e., in the absence of a vector). Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells. The nucleic acids are administered in any suitable manner, preferably with pharmaceutically acceptable carriers. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention as discussed supra. The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The dose will be determined by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, or transfected cell type in a particular patient. In determining the effective amount of the vector to be administered in the treatment or prophylaxis of conditions owing to HIV infection, the physician evaluates circulating plasma levels of the vector, vector toxicities, progression of the disease, and the production of anti-vector antibodies. In general, the dose equivalent of a naked nucleic acid from a vector (if employed) is from about 1 .mu.g to 100 .mu.g for a typical 70 kilogram patient, and doses of vectors which include a retroviral particle are calculated to yield an equivalent amount of therapeutic nucleic acid. For administration, inhibitors and transfected cells of the present invention can be administered at a rate determined by the LD-50 of the inhibitor, vector, or transfected cell type, and the side-effects of the inhibitor, vector or cell type at various concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses. In a preferred embodiment, prior to infusion, blood samples are obtained and saved for analysis. Between 1x108 and 1x1012 transfected cells are infused intravenously over 60-200 minutes. Vital signs and oxygen saturation by pulse oximetry are closely monitored. Blood samples are obtained 5 minutes and 1 hour following infusion and saved for subsequent analysis. Leukopheresis, transfection and reinfusion can be repeated are repeated every 2 to 3 months. After the first treatment, infusions can be performed on a out-patient basis at the discretion of the clinician. If the reinfusion is given as an outpatient, the participant is monitored for at least 4, and preferably 8 hours following the therapy. Transfected cells are prepared for reinfusion according to established methods. See, Abrahamsen et al. (1991) J. Clin. Apheresis, 6: 48-53; Carter et al. (1988) J. Clin. Arpheresis, 4:113-117; Aebersold et al. (1988) J. Immunol. Meth., 112: 1-7; Muul et al. (1987) J. Immunol. Methods, 101:171-181 and Carter et al. (1 987) Transfusion 27: 362-365. After a period of about 2-4 weeks in culture, the cells should number between 1x108 and 1x1012. In this regard, the growth characteristics of cells vary from patient to patient and from cell type to cell type. About 72 hours prior to reinfusion of the transfected cells, an aliquot is taken for analysis of phenotype, and percentage of cells expressing the transdominant soluble Tat peptide. Claim 1 of 8 Claims What is claimed is: 1. An isolated transdominant soluble Tat peptide, comprising a transdominant peptide sequence having the sequence Cys-Phe-Xaa39 -Xaa40 -Xaa41 -Gly-Leu-Gly-Ile-Ser-Xaa47 -Gly-Xaa49 -Lys (SEQ ID NO:1), wherein Xaa39 is an amino acid residue selected from the group consisting of: Leu, Met, Ile, Thr, Gln, and Val; Xaa40 is an amino acid residue selected from the group consisting of: Thr, Arg, Lys, and Asn; Xaa41 is an amino acid residue exclusive of Lys; Xaa47 is an amino acid residue selected from the group consisting of: Tyr and His; Xaa49 is an amino acid residues selected from the group consisting of: Arg and Lys; wherein said peptide sequence comprises at least one amino acid residue substitution, which is an amino acid other than the wild type amino acid, at a position selected from the group consisting of: 44, 46, and 47, and wherein the amino acid substitution is an amino acid residue selected from the group consisting of: Gly, Ala, Val, Leu, Ile, Pro, Phe, Tyr, Trp, Cys, Met, Ser, Thr, Lys, Arg, His, Asp, Glu, Asn, and Gln; and wherein said transdominant soluble Tat peptide lacks an intact amino-terminal domain or an intact cysteine-rich domain.
____________________________________________
|
|
|