|
|
|
|
|
|
United States Patent: 6,753,138 Issued: June 22, 2004 Inventors: Schneider; Patrick A. (Temecula, CA); French; Cynthia K. (Irvine, CA); Yamamoto; Karen K. (San Clemente, CA) Assignee: Reprogen, Inc. (Irvine, CA) Appl. No.: 485193 Filed: December 27, 2000 PCT Filed: June 3, 1999 PCT NO: PCT/US99/12336 PCT PUB.NO.: WO99/63116 PCT PUB. Date: December 9, 1999 Abstract Prothymosin expression is up-regulated in endometriotic tissue. This invention provides methods of diagnosing endometriosis by detecting up-regulation of a prothymosin gene product, and methods of treating endometriosis by down-regulating expression of prothymosin in ectopic or eutopic endometriotic tissue. SUMMARY OF THE INVENTION Human endometrial tissue cultured in mice grows and mimics the progression to endometriosis. We have discovered that prothymosin expression is up-regulated in such tissue. This invention provides methods and materials that take advantage of this fact. More particularly, this invention provides methods of diagnosing endometriosis by detecting up-regulation of prothymosin in a sample from a patient suspected of having endometriosis. The methods involve detecting increased amounts of prothymosin mRNA or prothymosin protein in the sample compared to normal. This invention also provides methods of treating endometriosis by down-regulating the level of prothymosin activity in ectopic or eutopic endometrial tissue. These methods include decreasing transcription, processing or translation of prothymosin mRNA, as well as inhibiting biological activity of prothymosin. In one aspect this invention provides a method for use in the diagnosis of endometriosis in a subject. The method comprises the steps of: detecting a test amount of a prothymosin gene product in a sample from the subject; and comparing the test amount with a normal amount of the prothymosin gene product in a control sample. A test amount above the normal amount provides a positive indication in the diagnosis of endometriosis. In one aspect, the method comprises ectopic endometrial tissue, eutopic endometrial tissue, peritoneal fluid, blood, vaginal secretion or urine. In one embodiment of the method, the prothymosin gene product is prothymosin mRNA or cDNA. The step of detecting can comprise the steps of contacting the prothymosin mRNA or cDNA with a polynucleotide of at least 7 to about 50 nucleotides in length that specifically hybridizes to the prothymosin mRNA or cDNA and detecting hybridization between the polynucleotide and the mRNA or cDNA. In one embodiment, the polynucleotide is a primer and the step of detecting hybridization comprises initiating reverse transcription of prothymosin mRNA with the primer, and detecting a prothymosin mRNA reverse transcript. Detection of the reverse transcript indicates that the polynucleotide has specifically hybridized to prothymosin mRNA. In another embodiment the prothymosin mRNA or cDNA is immobilized and the step of contacting comprises contacting the immobilized mRNA or cDNA with the polynucleotide. In another embodiment the polynucleotide is immobilized and the step of contacting comprises contacting the immobilized polynucleotide with the prothymosin mRNA or cDNA. In another embodiment the biological sample is a fixed tissue sample and the step of contacting comprises contacting the polynucleotide with the mRNA or cDNA in situ on the fixed tissue sample. In another embodiment the step of detecting comprises the steps of amplifying the prothymosin mRNA or cDNA to produce an amplification product and detecting the amplification product. In one method, the step of detecting the amplification product comprises contacting the amplification product with a polynucleotide of at least 7 to about 50 nucleotides in length that specifically hybridizes to the amplification product, and detecting hybridization between the polynucleotide and the amplification product. In another method, the step of detecting the amplification product comprises determining the nucleotide sequence of the amplification product. In another method, the step of detecting the amplification product comprises determining the mass of the amplification product. In another embodiment, the prothymosin gene product is prothymosin polypeptide. In one method, the step of detecting comprises detecting binding prothymosin polypeptide by immunoassay. The immunoassay can be non-competitive or competitive. A competitive immunoassay comprises detecting binding between the prothymosin polypeptide and an antibody comprising a detectable moiety, e.g., selected from the group consisting of a fluorescent label, a radioactive label, an enzymatic label, a biotinyl group, or an epitope recognized by a secondary reporter. A non-competitive immunoassay comprises the steps of capturing the prothymosin polypeptide from the sample on a solid phase with a first antibody specific for prothymosin polypeptide; and detecting capture of the prothymosin polypeptide by contacting the solid phase with a second antibody specific for prothymosin polypeptide and detecting binding between the second antibody and prothymosin polypeptide. Another non-competitive immunoassay comprises the steps of binding the prothymosin polypeptide from the sample to a solid phase; and detecting the prothymosin polypeptide by contacting the solid phase with an antibody specific for prothymosin polypeptide and detecting binding between the antibody and prothymosin polypeptide. In another embodiment the method involves detecting the polypeptide by contacting the sample with an affinity agent that binds to prothymosin polypeptide and detecting binding between the affinity agent and the prothymosin polypeptide. In another method, the step of detecting comprises detecting an analyte in the sample having the mass of prothymosin polypeptide. In another aspect this invention provides method for use in the monitoring the progress of endometriosis in a subject comprising the steps of detecting a first test amount of a prothymosin gene product in a sample from the subject at a first time; detecting a second test amount of the prothymosin gene product in a sample from the subject at a second, later time; and comparing the first test amount with the second test amount. An increase in the amount between the first time and the second time indicates progression of endometriosis and a decrease in the amount between the first time and the second time indicates remission of endometriosis. In another aspect this invention provides a kit comprising a compound that binds a prothymosin gene product and instructions to (1) use the compound for detecting prothymosin in a patient sample, and (2) to diagnose endometriosis based on an elevated amount of the prothymosin gene product in the sample compared with a normal amount of prothymosin. In another aspect this invention provides method for use in the diagnosis of endometriosis in a subject comprising detecting a prothymosin gene product in endometrial tissue from the subject in vivo, whereby detection of the gene product provides a positive indication in the diagnosis of endometriosis. In one embodiment the method comprises administering to the subject a compound that specifically binds to a prothymosin gene product and detecting binding between the compound and the prothymosin gene product. In one embodiment of the method the compound comprises a gamma-emitting or positron-emitting radioisotope and binding is detected by detecting the radioisotope by camera imaging or Geiger counter. In another embodiment of the method the compound comprises a paramagnetic isotope and binding is detected by detecting the paramagnetic isotope by magnetic resonance imaging ("MRI"). In another aspect this invention provides method for the treatment of endometriosis in a subject comprising administering to the subject a probe comprising a detectable label and a ligand that specifically binds a prothymosin gene product, to allow binding between the probe and the prothymosin gene product; identifying an endometriotic lesion in situ by locating bound label; and excising the endometriotic lesion. In one embodiment this method comprises administering the probe into the peritoneum of the subject, wherein the probe comprises an antibody ligand that specifically binds prothymosin and a radioactive label; identifying an endometriotic lesion in situ by locating bound probe with a Geiger counter; and excising the endometriotic lesion laparoscopically. In another aspect this invention provides a screening method for determining whether a compound modulates the expression of a prothymosin gene product in an endometrial cell comprising the steps of contacting the cell with the compound; and determining whether expression of the prothymosin gene product is different that expression in a control cell which has not been contacted with the compound. A difference between expression in the endometrial cell and the control cell indicates that the agent modulates expression of the prothymosin gene product. In one aspect of this method the endometrial cell is comprised within endometriotic tissue cultured as a xenograft in a mouse; the step of contacting comprises administering the compound to the mouse; and the step of determining comprises in vitro determination of expression of the gene product after removing the tissue from the mouse. In another aspect this invention provides a method for the treatment of endometriosis in a subject comprising the step of administering to the subject a compound that decreases prothymosin activity in eutopic endometrial tissue or ectopic endometrial tissue in the subject. The compound can inhibit expression of prothymosin mRNA or the activity of prothymosin protein. In one aspect the inhibitory polynucleotide is a polynucleotide comprising an antisense sequence of at least 7 nucleotides that specifically hybridizes to a nucleotide sequence within prothymosin mRNA, whereby the polynucleotide inhibits the activity of the prothymosin mRNA. In another aspect the inhibitory polynucleotide is a ribozyme that cleaves prothymosin mRNA. In another aspect the endometrial cells are transfected with an expression vector comprising expression control sequences operatively linked to a nucleotide sequence encoding the antisense polynucleotide, whereby the vector expresses the polynucleotide. DETAILED DESCRIPTION OF THE INVENTION Up-Regulation of Prothymosin as a Marker for Endometriosis We have discovered that prothymosin is up-regulated in human endometrial tissue cultured in a mouse model of endometriosis. This discovery enables methods of diagnosing endometriosis by detecting an increase in prothymosin expression and methods of treating endometriosis by down-regulating prothymosin activity. The experiments by which we made this discovery are described in detail in the Examples. However, we summarize those experiments here. Severe Combined Immunodeficient (SCID) mice were used as hosts for normal human endometrial tissue. The mice do not reject these xenografts. In growth, the tissue mimics tissue lesions in endometriosis. This method is described in more detail in co-pending U.S. patent application Ser. No. 09/047,910, filed Mar. 25, 1998 (J. Boyd et al.). We prepared a subtracted library using the cDNA from the xenograft tissue as a tester and normal human endometrial cDNA and normal mouse cDNA as a driver. We used the subtracted probe to screen an endometrial carcinoma library. From this screening we identified a clone, referred to as "REPRO-EN-203." Based on its sequence, we determined that REPRO-EN-203 encoded prothymosin. Prothymosin is a highly acidic precursor protein of thymosin. Prothymosin is a nuclear protein involved in normal cell proliferation and has immunoregulatory effects on various cell types including natural killer cells and T cells. Prothymosin stimulates NK and lymphokine-activated killer cells by enhancing the expression of IL-2 and IL-1 receptors. In addition, prothymosin acts as an accessory signal for the adhesion of IL-2-activated lymphocytes to endothelial cells via the lymphocyte function-associated antigen-1 (LFA-1) family of integrin adhesion molecules. It is interesting to note that ICAM-1, the ligand for LFA-1, is expressed at high levels in endometrial stromal cells from normal subjects, but is shed in endometriosis patients, which may result in reduced immunodetection of ectopic endometrial tissue. "Prothymosin" refers to a protein that stimulates cell proliferation and that has an amino acid sequence substantially identical to the amino acid sequence presented herein. This includes allelic variants of prothymosin. The mass of prothymosin polypeptide is about 12 kD. The size of prothymosin mRNA is about 1.2 kb. The nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO:2) of clone REPRO-EN-203 is presented in Table 1. We also compared the sequence of REPRO-EN-203 with a sequence for prothymosin from GenBank. The sequences were identical in the coding region and virtually identical in the non-coding regions. TABLE 1
1 GAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGCAGC 50
51 CGCCTCCGCCGCGCGCCTCCTCCGCCGCCGCGGACTC&GGCAGCTTTATC 100
101 GCCAGAGTCCCTGAACTCTCGCTTTCTTTTTAATCCCCTGCATCGGATCA 150
151 CCGGCGTGCCCCACCATGTCAGACGCAGCCGTAGACACCAGCTCCGAAAT 200
METSerAspAlaAlaValAspThrSerSerGluIl
201 CACCACCAAGGACTTAAAGGAGAAGAAGGAAGTTGTGGAAGAGGCAGAAA 250
eThrThrLysAspLeuLysGluLysLysGluValValGluGluAlaGluA
251 ATGGAAGAGACGCCCCTGCTAACGGGAATGCTAATGAGGAAAATGGGGAG 300
snGlyArgAspAlaProAlaAsnGlyAsnAlaAsnGluGluAsnGlyGlu
301 CAGGAGGCTGACAATGAGGTAGACGAAGAAGAGGAAGAAGGTGGGGAGGA 350
GlnGluAlaAspAsnGluValAspGluGluGluGluGluGlyGlyGluGl
351 AGAGGAGGAGGAAGAAGAAGGTGATGGTGAGGAAGAGGATGGAGATGAAG 400
uGluGluGluGluGluGluGlyAspGlyGluGluGluAspGlyAspGluA
401 ATGAGGAAGCTGAGTCAGCTACGGGCAAGCGGGCAGCTGAAGATGATGAG 450
spGluGluAlaGluSerAlaThrGlyLysArgAlaAlaGluAspAspGlu
451 GATGACGATGTCGATACCAAGAAGCAGAAGACCGACGAGGATGACTAGAC 500
AspAspAspValAspThrLysLysGlnLysThrAspGluAspAspEnd
501 AGCAAAAAAGGAAAAGTTAAACTAAAAAAAAAAAGGCCGCCGTGACCTAT 550
551 TCACCCTCCACTTCCCGTCTCAGAATCTAAACGTGGTCACCTTCGAGTAG 600
601 AGAGGCCCGCCCGCCCACCGTGGGCAGTGCCACCCGCAGATGACACGCGC 650
651 TCTCCACCACCCAACCCAAACCATGAGAATTTGCAACAGGGGAGGAAAAA 700
701 AGAACCAAAACTTCCAAGGCCCTGCTTTTTTTCTTAAAAGTACTTTAAAA 750
751 AGGAAATTTGTTTGTATTTTTTATTTACATTTTATATTTTTGTACATATT 800
801 GTTAGGGTCAGCCATTTTTAATGATCTCGGATGACCAAACCAGCCTTCGG 850
851 AGCGTTCTCTGTCCTACTTCTGACTTTACTTGTGGTGTGACCATGTTCAT 900
901 TATAATCTCAAAGGAGAAAAAAAACCTTGTAAAAAAAGCAAAAATGACAA 950
951 CAGAAAAACAATCTTATTCCGAGCATTCCAGTAACTTTTTTGTGTATGTA 1000
1001 CTTAGCTGTACTATAAGTAGTTGGTTTGTATGAGATGGTTAAAAAGGCCA 1050
1051 AAGATAAAAGGTTTCTTTTTTTTTCCTTTTTTGTCTATGAAGTTGCTGTT 1100
1101 TATTTTTTTTGGCCTGTTTGATGTATGTGTGAAACAATGTTGTCCAACAA 1150
1151 TAAACAGGAAT 1161
III. Methods of Diagnosing, Prognosing or Monitoring the Course of Endometriosis A. Introduction Prothymosin expression is up-regulated in ectopic endometriotic tissue in endometriosis. This invention provides methods for diagnosing, prognosing or monitoring the course of endometriosis. Diagnostic methods involve detecting up-regulation of prothymosin by determining a test amount of a prothymosin gene product (e.g., mRNA, cDNA or polypeptide, including fragments thereof that may have resulted from degradation) in a biological sample from a patient or in the patient in situ, and comparing that amount with a normal amount or range for the prothymosin gene product. If the diagnostic amount is higher than the control amount, this is a positive sign in the diagnosis of endometriosis. Methods of prognosing endometriosis also involve determining the amount of a prothymosin gene product in a biological sample from the patient. The method further involves comparing that amount to a prognostic amount. Various amounts of the gene product in a sample are consistent with certain prognoses for endometriosis. The detection of an amount of prothymosin mRNA or polypeptide at a particular prognostic level provides a prognosis for the subject. Methods for monitoring the progress of endometriosis involve detecting the amount of a prothymosin gene product in the subject at a first and a second time, and comparing the amounts. A change in the amount indicates a change in the course of the disease, with a decreasing amount indicating remission of endometriosis and increase indicating progression of the endometriosis. Such assays are useful to evaluate the efficacy of a particular therapeutic intervention in patients being treated for endometriosis. B. Sample Collection A first step in a diagnostic or prognostic method is providing a biological sample to be tested. Increased expression of prothymosin in endometriosis can be detected in a variety of tissue and liquid biological samples. These include, for example, ectopic endometrial tissue and eutopic endometrial tissue (which express the gene product), peritoneal fluid (which can contain endometrial cells or their contents), vaginal secretions, urine or blood. Samples thus include cells (including whole cells, cell fractions, cell extracts), tissues, and tissue samples such as fme needle biopsy samples and body fluids. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes. A "biological sample" obtained from a patient can be referred to either as a "biological sample" or a "patient sample." It will be appreciated that analysis of a "patient sample" need not necessarily require removal of cells or tissue from the patient. For example, appropriately labeled prothymosin agents (e.g., antibodies or nucleic acids) can be administered into a patient and visualized (when bound to the target) using standard imaging technology (e.g., CAT, NMR, and the like.) The sample may be pre-treated as necessary by dilution in an appropriate buffer solution or concentrated, if desired. Any of a number of standard aqueous buffer solutions, employing one of a variety of buffers, such as phosphate, Tris-buffer, or the like, at physiological pH can be used. Assay formats using flow activated cell sorting ("FACS") or equivalent instruments or methods have advantages when measuring prothymosin gene products in a heterogeneous sample (such as a biopsy sample containing both normal and malignant cells). C. Normal, Diagnostic, and Prognostic Values In the assays of this invention, the prothymosin gene product is detected and optionally quantified to yield a "test amount." The test amount is then compared to a normal amount of prothymosin in the sample. An amount above a normal amount is a positive sign in a diagnosis of endometriosis. Particular methods of detection and quantitation are described below. Normal or baseline levels or ranges of prothymosin expression can be determined for any particular sample type, patient or population. Generally, baseline (normal) levels of prothymosin protein or mRNA are determined by quantifying the amount of prothymosin protein and/or mRNA in a biological sample type from normal (healthy) subjects, e.g., a human subject. An amount of prothymosin gene product may be determined or expressed on a per sample volume basis, if the sample does not include cells. Preferably, it is determined or expressed on a per cell basis. To determine the cellularity of a sample, one can measure the level of a constitutively expressed gene product or other gene product expressed at known levels in cells of the type from which the sample was taken. Alternatively, normal values of prothymosin protein or prothymosin mRNA can be determined by quantifying the amount of prothymosin protein/RNA in cells or tissues known to be healthy, which are obtained from the same patient from whom diseased (or possibly diseased) cells are collected or from a healthy individual. It will be appreciated that the assay methods do not necessarily require measurement of absolute values of prothymosin because relative values are sufficient for many applications of the methods of the present invention. One of skill will appreciate that, in addition to the quantity or abundance of prothymosin gene products, variant or abnormal expression patterns or variant or abnormal expression products (e.g., mutated transcripts, truncated or non-sense polypeptides) may also be identified by comparison to normal expression levels and normal expression products. D. Assays for Prothymosin Gene Products The diagnostic and prognostic assays of this invention involve detecting and quantifying a prothymosin gene product from a patient sample. Prothymosin gene products include prothymosin mRNA or prothymosin protein. This section describes various methods of detecting and quantifying these products. 1. Polynucleotide Assays In one embodiment, this invention provides for methods of detecting and/or quantifying expression of prothymosin mRNA or cDNA using amplification-based assays with or without signal amplification, hybridization based assays, and combination amplification-hybridization assays. a. Preparation Of Polynucleotides Polynucleotide assays are performed with a sample of nucleic acid isolated from the biological sample. The polynucleotide (e.g., genomic DNA, RNA or cDNA) may be isolated from the sample according to any of a number of methods well known to those of skill in the art. Methods for isolating nucleic acids are well known to those of skill in the art and are described, for example, Tijssen, P. ed. of LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, PART I. THEORY AND NUCLEIC ACID PREPARATION, Elsevier, N.Y. (1993) Chap. 3; Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, F. M. Ausubel et al., eds., (Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.). In alternative embodiments, it is not necessary to isolate nucleic acids (e.g., total or polyA+ RNA) from the biological sample prior to carrying out amplification, hybridization or other assays. These embodiments have certain advantages when RNA is to be measured, because they reduce the possibility of loss of mRNA during isolation and handling. For example, many amplification techniques such as PCR and RT-PCR defmed above can be carried out using permeabilized cells (histological specimens and FACS analyses), whole lysed cells, or crude cell fractions such as certain cell extracts. Preferably, steps are taken to preserve the integrity of the target nucleic acid (e.g., mRNA) if necessary (e.g., addition of RNAase inhibitors). Amplification and hybridization assays can also be carried out in situ, for example, in thin tissue sections from a biopsy sample or from a cell monolayer (e.g., blood cells or dis-aggregated tissue culture cells). Amplification can also be carried out in an intact whole cell or fixed cells. For example, PCR, RT-PCR, or LCR amplification methods may be carrier out, as is well known in the art, in situ, e.g., using a polymerase or ligase, a primer or primer(s), and (deoxy)ribonucleoside triphosphates (if a polymerase is employed), and reverse transcriptase and primer (if RNA is to be transcribed and the cDNA is to be detected) on fixed, permeabilized, or microinjected cells to amplify target prothymosin RNA. This method is often useful when fluorescently-labeled dNTPs, primers, or other components are used in conjunction with microscopy, FACS analysis or the equivalent. b. Amplification-based Assays In one embodiment, the assays of the present invention are amplification-based assays for detection of a prothymosin gene product (e.g., mRNA or cDNA; hereinafter also referred to as "target"). In an amplification based assay, all or part of an polynucleotide target is amplified, and the amplification product is then detected directly or indirectly. This includes detecting the amplification product by hybridization with a probe, by detecting a product of the appropriate size on a gel or by mass spectrometry, for example, of by determining the sequence of at least a part of the amplification product. When there is no underlying gene product to act as a template, no amplification product is produced (e.g., of the expected size), or amplification is non-specific and typically there is no single amplification product. In contrast, when the underlying gene or gene product is present, the target sequence is amplified, providing an indication of the presence and/or quantity of the underlying gene or mRNA. Target amplification-based assays are well known to those of skill in the art. Primers and probes for detecting prothymosin gene products may be designed and produced by those of skill by referring to the prothymosin sequence. Suitable primers and probes are sufficiently complementary to the prothymosin gene product to hybridize to the target nucleic acid. Primers are usually between about 10 and about 100 bases, typically between about 12 and about 50 bases, and may amplify all, or any portion, of the prothymosin gene product. Single oligomers (e.g., U.S. Pat. No. 5,545,522), nested sets of oligomers, or even a degenerate pool of oligomers may be employed for amplification. Two suitable primers for detecting prothymosin mRNA or cDNA sequences are: 5' primer: 5'--ctgacaatgaggtagacgaag--3' (SEQ ID NO:3); 3' primer: 5'--agtaaagtcagaagtaggac--3' (SEQ ID NO:4). In one embodiment, a prothymosin gene product is amplified and detected using the polymerase chain reaction (including all variants, e.g., reverse-transcriptase-PCR; the Sunrise Amplification System (Oncor, Inc, Gaithersburg Md.); and numerous others known in the art). In one illustrative embodiment, PCR amplification is carried out in a 50 .mu.l solution containing the nucleic acid sample (e.g., cDNA obtained through reverse transcription of mRNA), 100 .mu.M in each dNTP (dATP, dCTP, dGTP and dTTP; Pharmacia LKB Biotechnology, N.J.), the mRNA-specific PCR primer(s), 1 unit/Taq polymerase (Perkin Elmer, Norwalk Conn.), 1xPCR buffer (50 mM KCI, 10 mM Tris, pH 8.3 at room temperature, 1.5 mM MgCl2, 0.01 % gelatin) with the amplification run for about 30 cycles at 94oFor 45 sec, 55oFor 45 sec and 72oFor 90 sec. However, as will be appreciated, numerous variations may be made to optimize the PCR amplification for any particular reaction. Other suitable target amplification methods include the ligase chain reaction (LCR; e.g., Wu and Wallace, 1989, Genomics 4:560; Landegren et al., 1988, Science, 241: 1077, Barany, 1991, Proc. Natl. Acad. Sci. USA 88:189 and Barringer et al., 1990, Gene, 89: 117); strand displacement amplification (SDA; e.g., Walker et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:392-396); transcription amplification (e.g., Kwoh et al., 1989, Proc. Natil. Acad. Sci. USA, 86: 1173); self-sustained sequence replication (3SR; e.g., Fahy et al., 1992, PCR Methods Appl. 1:25, Guatelli et al., 1990, Proc. Nat'l. Acad. Sci. USA, 87: 1874); the nucleic acid sequence based amplification (NASBA, Cangene, Mississauga, Ontario; e.g., Compton, 1991, Nature 350:91); the transcription-based amplification system (TAS); and the self-sustained sequence replication system (SSR). One useful variant of PCR is PCR ELISA (e.g., Boehringer Mannheim Cat. No. 1 636 111) in which digoxigenin-dUTP is incorporated into the PCR product. The PCR reaction mixture is denatured and hybridized with a biotin-labeled oligonucleotide designed to anneal to an internal sequence of the PCR product. The hybridization products are immobilized on streptavidin coated plates and detected using anti-digoxigenin antibodies. Examples of techniques sufficient to direct persons of skill through in vitro amplification methods are found in PCR TECHNOLOGY: PRINCIPLES AND APPLICATIONS FOR DNA AMPLIFICATION, H. Erlich, Ed. Freeman Press, New York, N.Y. (1992); PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS, eds. Innis, Gelfand, Snisky, and White, Academic Press, San Diego, Calif. (1990); Mattila et al., 1991, Nucleic Acids Res. 19: 4967; Eckert and Kunkel, (1991) PCR METHODS AND APPLICATIONS 1: 17; PCR, eds. McPherson, Quirkes, and Taylor, IRL Press, Oxford; U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188; Barringer et al., 1990, Gene, 89:117; Lomell et al., 1989, J. Clin. Chem., 35:1826. Amplified products may be directly analyzed, e.g., by size as determined by gel electrophoresis; by hybridization to a target nucleic acid immobilized on a solid support such as a bead, membrane, slide, or chip; by sequencing; immunologically, e.g., by PCR-ELISA, by detection of a fluorescent, phosphorescent, or radioactive signal; or by any of a variety of other well-known means. For example, an illustrative example of a detection method uses PCR primers augmented with hairpin loops linked to fluorescein and a benzoic acid derivative that serves as a quencher, such that fluorescence is emitted only when the primers unfold to bind their targets and replication occurs. In addition, methods are known to increase signal produced by amplification of the target sequence may be used. Methods for augmenting the ability to detect the amplified target include signal amplification system such as: branched DNA signal amplification (e.g., U.S. Pat. No. 5,124,246; Urdea, 1994, Bio/Tech. 12:926); tyramide signal amplification (TSA) system (DuPont); catalytic signal amplification (CSA; Dako); Q Beta Replicase systems (Tyagi et al., 1996, Proc. Nat. Acad. Sci. USA, 93: 5395 ); or the like. One of skill in the art will appreciate that whatever amplification method is used, a variety of quantitative methods known in the art can be used if quantitation is desired. Detailed protocols for quantitative PCR may be found in PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, Innis et al., Academic Press, Inc. N.Y., (1990) and Ausubel et al., supra (Unit 15) and Diaco, R. (1995) Practical Considerations for the Design of Quantitative PCR Assays, in PCR STRATEGIES, pg. 84-108, Innis et al. eds, Academic Press, New York; and U.S. Patent No. 5,629,154. c. Hybridization-based Assays A variety of methods for specific DNA and RNA measurement using nucleic acid hybridization techniques are known to those of skill in the art (see Sambrook et al., supra). Hybridization based assays refer to assays in which a probe nucleic acid is hybridized to a target nucleic acid. Methods of selecting nucleic acid probe sequences for use in nucleic acid hybridization are discussed in Sambrook et al., supra and are based on the prothymosin gene sequence. In some formats, at least one of the target and probe is immobilized. The immobilized nucleic acid may be DNA, RNA, or another oligo- or poly-nucleotide, and may comprise natural or non-naturally occurring nucleotides, nucleotide analogs, or backbones. Such assays may be in any of several formats including: Southern, Northern, dot and slot blots, high-density polynucleotide or oligonucleotide arrays (e.g., GeneChips.TM. Affymetrix), dip sticks, pins, chips, or beads. All of these techniques are well known in the art and are the basis of many commercially available diagnostic kits. Hybridization techniques are generally described in Hames et al., ed., NUCLEIC ACID HYBRIDIZATION, A PRACTICAL APPROACH IRL Press, (1985); Gall and Pardue Proc. Natl. Acad. Sci., U.S.A., 63: 378-383 (1969); and John et al., Nature, 223: 582-587 (1969). One common format is direct hybridization, in which a target nucleic acid is hybridized to a labeled, complementary probe. Typically, labeled nucleic acids are used for hybridization, with the label providing the detectable signal. One method for evaluating the presence, absence, or quantity of prothymosin mRNA is carrying out a Northern transfer of RNA from a sample and hybridization of a labeled prothymosin-specific nucleic acid probe. Other common hybridization formats include sandwich assays and competition or displacement assays. Sandwich assays are commercially useful hybridization assays for detecting or isolating nucleic acid sequences. Such assays utilize a "capture" nucleic acid covalently immobilized to a solid support and a labeled "signal" nucleic acid in solution. The biological or clinical sample will provide the target nucleic acid. The "capture" nucleic acid and "signal" nucleic acid probe hybridize with the target nucleic acid to form a "sandwich" hybridization complex. To be effective, the signal nucleic acid cannot hybridize with the capture nucleic acid. The present invention also provides probe-based hybridization assays for prothymosin gene products employing arrays of immobilized oligonucleotide or polynucleotides to which a prothymosin nucleic acid can hybridize (i.e., to some, but usually not all or even most, of the immobilized oligo- or poly-nucleotides). High density oligonucleotide arrays or polynucleotide arrays provide a means for efficiently detecting the presence and characteristics (e.g., sequence) of a target nucleic acid (e.g., prothymosin gene, mRNA, or cDNA). Techniques are known for producing arrays containing thousands of oligonucleotides complementary to defmed sequences, at defmed locations on a surface using photolithographic techniques for synthesis in situ (see, e.g., U.S. Pat. Nos. 5,578,832; 5,556,752; and 5,510,270; Fodor et al., 1991, Science 251:767; Pease et al., 1994, Proc. Natl. Acad. Sci. USA 91:5022; and Lockhart et al., 1996, Nature Biotech 14:1675) or other methods for rapid synthesis and deposition of defmed oligonucleotides (Blanchard et al., 1996, Biosensors & Bioelectronics 11:687). When these methods are used, oligonucleotides (e.g., 20-mers) of known sequence are synthesized directly on a surface such as a derivatized glass slide. Usually, the array produced is redundant, having several oligonucleotide probes on the chip specific for the prothymosin polynucleotide to be detected. An alternative means for detecting expression of a gene encoding a prothymosin protein is in situ hybridization. In situ hybridization assays are well known and are generally described in Angerer et al., METHODS ENZYMOL., 152: 649-660 (1987) and Ausubel et al., supra. In an in situ hybridization assay, cells or tissue specimens are fixed to a solid support, typically in a permeabilized state, typically on a glass slide. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of labeled nucleic acid probes (e.g., 35 S-labeled riboprobes, fluorescently labeled probes) completely or substantially complementary to prothymosin mRNA. Free probe is removed by washing and/or nuclease digestion, and bound probe is visualized directly on the slide by autoradiography or an appropriate imaging techniques, as is known in the art. 2. Prothymosin Polypeptide Assays a. Generally The present invention provides methods and reagents for detecting and quantifying prothymosin polypeptides. These methods include analytical biochemical methods such as electrophoresis, mass spectroscopy, chromatographic methods and the like, or various immunological methods such as radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, western blotting, affinity capture mass spectrometry, biological activity and others described below and apparent to those of skill in the art upon review of this disclosure. b. Immunoassays The present invention also provides methods for detection of prothymosin polypeptides employing one or more anti-prothymosin antibody reagents (i.e., immunoassays). As used herein, an immunoassay is an assay that utilizes an antibody (as broadly defmed herein and specifically includes fragments, chimeras and other binding agents) that specifically binds a prothymosin polypeptide or epitope. A number of well established immunological binding assay formats suitable for the practice of the invention are known (see, e.g., U.S. Pat. Nos. 4,366,241; 4,376,110; 4,517,288; and 4,837,168). See, e.g., METHODS IN CELL BIOLOGY VOLUME 37: ANTIBODIES IN CELL BIOLOGY, Asai, ed. Academic Press, Inc. New York (1993); BASIC AND CLINICAL IMMUNOLOGY 7th Edition, Stites & Terr, eds. (1991); Harlow and Lane, supra [e.g., Chapter 14], and Ausubel et al., supra, [e.g., Chapter 11]. Typically, immunological binding assays (or immunoassays) utilize a "capture agent" to specifically bind to and, often, immobilize the analyte to a solid phase. In one embodiment, the capture agent is a moiety that specifically binds to a prothymosin polypeptide or subsequence, such as an anti-prothymosin antibody. Usually the prothymosin gene product being assayed is detected directly or indirectly using a detectable label. The particular label or detectable group used in the assay is usually not a critical aspect of the invention, so long as it does not significantly interfere with the specific binding of the antibody or antibodies used in the assay. The label may be covalently attached to the capture agent (e.g., an anti-prothymosin antibody), or may be attached to a third moiety, such as another antibody, that specifically binds to the prothymosin polypeptide. The present invention provides methods and reagents for competitive and noncompetitive immunoassays for detecting prothymosin polypeptides. Noncompetitive immunoassays are assays in which the amount of captured analyte (in this case prothymosin) is directly measured. One such assay is a two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering epitopes on the prothymosin protein. See, e.g., Maddox et al., 1983, J. Exp. Med., 158:1211 for background information. In one preferred "sandwich" assay, the capture agent (e.g., an anti-prothymosin antibody) is bound directly to a solid substrate where it is immobilized. These immobilized antibodies then capture any prothymosin protein present in the test sample. The prothymosin thus immobilized can then be labeled, i.e., by binding to a second anti-prothymosin antibody bearing a label. Alternatively, the second anti-prothymosin antibody may lack a label, but be bound by a labeled third antibody specific to antibodies of the species from which the second antibody is derived. The second antibody alternatively can be modified with a detectable moiety, such as biotin, to which a third labeled molecule can specifically bind, such as enzyme-labeled streptavidin. In competitive assays, the amount of prothymosin protein present in the sample is measured indirectly by measuring the amount of an added (exogenous) prothymosin displaced (or competed away) from a capture agent (e.g., anti-prothymosin antibody) by the prothymosin protein present in the sample. A hapten inhibition assay is another example of a competitive assay. In this assay prothymosin protein is immobilized on a solid substrate. A known amount of anti-prothymosin antibody is added to the sample, and the sample is then contacted with the immobilized prothymosin protein. In this case, the amount of anti-prothymosin antibody bound to the immobilized prothymosin protein is inversely proportional to the amount of prothymosin protein present in the sample. The amount of immobilized antibody may be detected by detecting either the immobilized fraction of antibody or the fraction of the antibody that remains in solution. In this aspect, detection may be direct, where the antibody is labeled, or indirect where the label is bound to a molecule that specifically binds to the antibody as described above. c. Other Antibody-based Assay Formats The invention also provides reagents and methods for detecting and quantifying the presence of prothymosin polypeptide in the sample by using an immunoblot (Western blot) format. Another immunoassay is the so-called "lateral flow chromatography." In a non-competitive version of lateral flow chromatography, a sample moves across a substrate by, e.g., capillary action, and encounters a mobile labeled antibody that binds the analyte forming a conjugate. The conjugate then moves across the substrate and encounters an immobilized second antibody that binds the analyte. Thus, immobilized analyte is detected by detecting the labeled antibody. In a competitive version of lateral flow chromatography a labeled version of the analyte moves across the carrier and competes with unlabeled analyte for binding with the immobilized antibody. The greater the amount of the analyte in the sample, the less the binding by labeled analyte and, therefore, the weaker the signal. See, e.g., May et al., U.S. Pat. No. 5,622,871 and Rosenstein, U.S. Pat. No. 5,591,645. d. Solid Phases: Substrates, Solid Supports, Membranes, Filters As noted supra, depending upon the assay, various components, including the antigen, target antibody, or anti-prothymosin antibody, may be bound to a solid surface or support (i.e., a substrate, membrane, or filter paper). Many methods for immobilizing biomolecules to a variety of solid surfaces are known in the art. For instance, the solid surface may be a membrane (e.g., nitrocellulose), a microtiter dish (e.g., PVC, polypropylene, or polystyrene), a test tube (glass or plastic), a dipstick (e.g. glass, PVC, polypropylene, polystyrene, latex, and the like), a microcentrifuge tube, or a glass or plastic bead. The desired component may be covalently bound or noncovalently attached through nonspecific bonding. A wide variety of organic and inorganic polymers, both natural and synthetic may be employed as the material for the solid surface. Illustrative polymers include polyethylene, polypropylene, poly(4-methylbutene), polystyrene, polymethacrylate, poly(ethylene terephthalate), rayon, nylon, poly(vinyl butyrate), polyvinylidene difluoride (PVDF), silicones, polyformaldehyde, cellulose, cellulose acetate, nitrocellulose, and the like. Other materials which may be employed, include paper, glasses, ceramics, metals, metalloids, semiconductive materials, cements or the like. In addition, substances that form gels, such as proteins (e.g., gelatins), lipopolysaccharides, silicates, agarose and polyacrylamides can be used. Polymers which form several aqueous phases, such as dextrans, polyalkylene glycols or surfactants, such as phospholipids, long chain (12-24 carbon atoms) alkyl ammonium salts and the like are also suitable. Where the solid surface is porous, various pore sizes may be employed depending upon the nature of the system. e. Mass Spectrometry The mass of a molecule frequently can be used as an identifier of the molecule. Therefore, methods of mass spectrometry can be used to identify a protein analyte. Mass spectrometers can measure mass by determining the time required for an ionized analyte to travel down a flight tube and to be detected by an ion detector. One method of mass spectrometry for proteins is matrix-assisted laser desorption/ionization mass spectrometry ("MALDI"). In MALDI the analyte is mixed with an energy absorbing matrix material that absorbs energy of the wavelength of a laser and placed on the surface of a probe. Upon striking the matrix with the laser, the analyte is desorbed from the probe surface, ionized, and detected by the ion detector. See, for example, Hillenkamp et al., U.S. Pat.No. 5,118,937. Other methods of mass spectrometry for proteins are described in Hutchens and Yip, U.S. Pat. No. 5,719,060. In one such method referred to as Surfaces Enhanced for Affinity Capture ("SEAC") a solid phase affinity reagent that binds the analyte specifically or non-specifically, such as an antibody or a metal ion, is used to separate the analyte from other materials in a sample. Then the captured analyte is desorbed from the solid phase by, e.g., laser energy, ionized, and detected by the detector. 3. Assay Combinations The diagnostic and prognostic assays described herein can be carried out in various combinations and can also be carried out in conjunction with other diagnostic or prognostic tests. For example, when the present methods are used to diagnose endometriosis, the presence of a prothymosin gene product can be used to determine the stage of the disease. Tests that may provide additional information include microscopic analysis of biopsy samples, detection of antigens (e.g., cell-surface markers) associated with endometriosis (e.g., using histocytochemistry, FACS, or the like). E. In Vivo Diagnosis and Treatment In another method of the invention, endometriosis can be diagnosed in vivo. The methods involve detecting binding between a prothymosin gene product and compound that specifically binds the product. The compound also includes a detectable label. In general, any conventional method for visualizing diagnostic imaging can be used. In one method, detection is performed by laparoscopy. The compound is introduced into the subject at the site of a suspected lesion and binding is detected using the laparoscope. Alternatively, the binding can be detected by, for example, magnetic resonance imaging (MRI) or electron spin resonance (ESR). Usually gamma-emitting and positron-emitting radioisotopes are used for camera imaging and paramagnetic isotopes are used for magnetic resonance imaging. Any amount of binding above background is a positive sign of endometriosis. Persons of skill in the art recognize that not every positive sign results in a definitive diagnosis of a disease. Endometriotic lesions can be removed surgically. However, lesions may be tiny, and difficult to identify by eye. This invention takes advantage of prothymosin as marker for endometriosis by providing a method to identify and remove endometriotic lesions. The method involves identifying endometriotic lesions in situ using a labeled probe directed to a prothymosin gene product and removing them surgically. In the practice of this method, a probe is provided. The probe binds to a prothymosin gene product and is labeled with a detectable marker that can be detected in a surgical procedure. The probe preferably is directed to prothymosin polypeptide, but can be directed to prothymosin mRNA. In particular, the probe can be an antibody that specifically binds prothymosin. A preferred label that can be detected during surgery is a radioactive label. Such labels can be identified with the use of, e.g., a Geiger counter. Surgery can proceed as follows. The labeled probe is introduced into the peritoneum of the patient for a time sufficient for the label to bind to endometriotic lesions. Unbound labeled probe is washed out. Then, endometriotic lesions are identified using a suitable detector. For example, in laparoscopic surgery, a Geiger counter may be introduced through the incision. Radioactive ("hot") spots indicate bound labeled and, therefore, an endometriotic lesion. These lesions are then removed from the patient. F. Kits The present invention also provides kits useful for the screening, monitoring, diagnosis and prognosis of patients with endometriosis. The kits include one or more reagents for detecting a prothymosin gene product (mRNA, cDNA or protein) or for quantifying expression of prothymosin. They further include instructions for using the amount of prothymosin gene product detected for diagnosing, prognosing or monitoring the course of endometriosis. Reagents for detecting a prothymosin gene product include any reagents described herein. Reagents for detecting polynucleotides include, for example, polynucleotide probes and primers that specifically bind to the prothymosin gene, RNA, cDNA, or portions thereof. Reagents for detecting prothymosin polypeptides include, for example, affinity agents, antibodies and protein ligands. Other materials in the can include reagents for carrying out the assays. These materials include, for example, reverse transcriptases, DNA polymerases, ligases), buffers, reagents (labels, dNTPs), etc. Polynucleotide or protein probes can be conjugated to another moiety such as a label and/or it can be immobilized on a solid phase. Kits may also contain a second antibody for detection of prothymosin polypeptide/antibody complexes or for detection of hybridized nucleic acid probes, as well as one or more prothymosin peptides or proteins for use as control or other reagents. Examples of such formats include those that detect a signal by histology (e.g., immunohistochemistry with signal-enhancing or target-enhancing amplification steps) or fluorescence-activated cell analysis or cell sorting (FACS). These formats are particularly advantageous when dealing with a highly heterogeneous cell population (e.g., containing multiple cells types in which only one or a few types have elevated prothymosin levels, or a population of similar cells expressing prothymosin at different levels). IV. Screening for Compounds that Inhibit Prothymosin Expression in Endometrial Cells Compounds that inhibit expression of a prothymosin gene product in endometrial cells are useful in the treatment of endometriosis. This invention provides methods of screening compounds for their ability to inhibit such expression. The methods involve contacting an endometrial cell that expresses a prothymosin gene product with the compound, and determining whether the compound modulates expression of the gene product. A. Tissue Sample In a preferred embodiment the tissue is human endometrial tissue that is cultured in an immunodeficient mouse. The compound is administered to the mouse. Then, the tissue is examined to determine expression of the prothymosin gene product. The mouse model is described in more detail in Example I. Alternatively, the compound can be screened in vitro using tissue from endometriotic lesions. B. Test Agents A test agent that is to be screened for its ability to modulate prothymosin expression is administered to the test animal or to the cultured cells in vitro. The choice of the agent to be tested is left to the discretion of the practitioner. However, because of their variety and ease of administration as pharmaceuticals, small molecules are preferred as test agents. 1. Chemistry The agent to be tested can be selected from a number of sources. For example, combinatorial libraries of molecules are available for screening. Using such libraries, thousands of molecules can be screened for regulatory activity. In one preferred embodiment, high throughput screening methods involve providing a library containing a large number of potential therapeutic compounds (candidate compounds). Such "combinatorial chemical libraries" are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds" or can themselves be used as potential or actual therapeutics. Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka (1991) Int. J. Pept. Prot. Res., 37: 487-493, Houghton et al. (1991) Nature, 354: 84-88). Peptide synthesis is by no means the only approach envisioned and intended for use with the present invention. Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptoids (PCT Publication No WO 91/19735, 26 Dec. 1991), encoded peptides (PCT Publication WO 93/20242, 14 Oct. 1993), random bio-oligomers (PCT Publication WO 92/00091, 9 Jan. 1992), benzodiazepines (U.S. Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs et al., (1993) Proc. Nat. Acad. Sci. USA 90: 6909-6913), vinylogous polypeptides (Hagihara et al. (1992) J. Amer. Chem. Soc. 114: 6568), nonpeptidal peptidomimetics with a Beta-D-Glucose scaffolding (Hirschmann et al., (1992) J. Amer. Chem. Soc. 114: 9217-9218), analogous organic syntheses of small compound libraries (Chen et al. (1994) J. Amer. Chem. Soc. 116: 2661), oligocarbamates (Cho, et al., (1993) Science 261:1303), and/or peptidyl phosphonates (Campbell et al., (1994) J. Org. Chem. 59: 658). See, generally, Gordon et al., (1994) J. Med. Chem. 37:1385, nucleic acid libraries, peptide nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083) antibody libraries (see, e.g., Vaughn et al. (1996) Nature Biotechnology, 14(3): 309-314), and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al. (1996) Science, 274: 1520-1522, and U.S. Pat. No. 5,593,853), and small organic molecule libraries (see, e.g., benzodiazepines, Baum (1993) C&EN, Jan 18, page 33, isoprenoids U.S. Pat. No. 5,569,588, thiazolidinones and metathiazanones U.S. Pat. No. 5,549,974, pyrrolidines U.S. Pat. Nos. 5,525,735 and 5,519,134, morpholino compounds U.S. Pat. No. 5,506,337, benzodiazepines U.S. Pat. No. 5,288,514, and the like). Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). 2. Route of Administration When the tissue is cultured as an endometrial xenograft, the agent can be administered by any route that gives it access to the tissue. In one embodiment, the agent is delivered to the peritoneal cavity where the xenograft has been implanted. However, the agent can be delivered by any potential route if the agent becomes a drug for use in ultimate treatment of endometriosis. The agent can be administered in the form of a pharmaceutical composition. This includes, for example, aqueous solutions for enteral, parenteral or transmucosal administration, e.g., for intravenous administration, as tonics and administration to mucous or other membranes as, for example, nose or eye drops; solid and other non-aqueous compositions for enteral or transdermal delivery, e.g., as pills, tablets, powders or capsules; transdermal or transmucosal delivery systems for topical administration, and aerosols or mists for delivery by inhalation. One advantage of delivery by a mode that is easy to administer, e.g., enteral or by intravenous or intramuscular injection is that such modes mimic possible modes of delivery should the agent be formulated as a pharmaceutical. C. Detecting Expression of Prothymosin After sufficient time has elapsed, the culture cells or explant tissue is tested to detect the presence and/or amount of expression of a prothymosin gene product. Usually, this time will be between about 6 minutes and about 10 days. When the tissue is being cultured in an immunodeficient mouse, the xenograft preferably is removed from the animal and analyzed in vitro. Detecting the prothymosin gene product can be accomplished by any method described known in the art or described herein. D. Determining Whether The Agent Modulates Prothymosin Expression The amount of prothymosin expression test and control tissue is determined. These amounts are recorded and subject to statistical analysis to determine whether any difference is statistically significant. A statistically significant difference (p<0.05) indicates that the agent modulates the expression of prothymosin in endometrial tissue. Thus, one can determine whether the agent reduces, increases or has no effect on the amount of prothymosin expression in an tissue. Agents identified to inhibit prothymosin expression are candidates as drugs for the prophylactic and therapeutic treatment of endometriosis. Agents can be subject to further analysis by, for example, studying their effect under more discriminating conditions, or by altering the agent to create a "second generation" agent for testing. Agents also can be tested in combination with other agents. The effect of the agent on other aspects of animal physiology also can be tested. V. Inhibitory Polynucleotides A. General Inhibitory polynucleotides directed against prothymosin gene or mRNA are useful in treating endometriosis. Inhibitory polynucleotides can inhibit prothymosin activity in a number of ways. According to one mechanism, the polynucleotide prevents transcription of the prothymosin gene (for instance, by triple helix formation). In another mechanism, the polynucleotide destabilizes the prothymosin and reduces its half-life. The polynucleotides can be directed to the coding region or adjacent non-coding regions, such as 5' up-stream region that contains expression control sequences. An inhibitory polynucleotide is a polynucleotide that is capable of hybridizing under stringent conditions with a target polynucleotide and that interferes with the transcription, processing, translation or other activity the target polynucleotide. Inhibitory polynucleotides generally are single-stranded and have a sequence of at least 7, 8, 9, 10, or 11 nucleotides capable of specifically hybridizing to the target sequence. RNA sequences generally require a sequence of at least 10 nucleotides for specific hybridization. Inhibitory polynucleotides include, without limitation, antisense molecules, ribozymes, sense molecules and triplex-forming molecules. While not wishing to be limited by theory, it is believed that inhibitory polynucleotides inhibit the function of a target, in part, by binding to the appropriate target sequence. An inhibitory polynucleotide can inhibit DNA replication or DNA transcription by, for example, interfering with the attachment of DNA or RNA polymerase to the promoter by binding to a transcriptional initiation site or a template. It can interfere with processing of mRNA, poly(A) addition to mRNA or translation of mRNA by, for example, binding to regions of the RNA transcript such as the ribosome binding site. It can promote inhibitory mechanisms of the cells, such as promoting RNA degradation via RNase action. The inhibitory polynucleotide can bind to the major groove of the duplex DNA to form a triple helical or "triplex" structure. Methods of inhibition using inhibitory polynucleotides therefore encompass a number of different approaches to altering expression of specific genes that operate by different mechanisms. These different types of inhibitory polynucleotide technology are described in C. Helene and J. Toulme, (1990) Biochim. Biophys. Acta., 1049:99-125. The literature also provides examples of antisense polynucleotide inhibition of the function of ribonucleoproteins. Hence, for ribonucleoprotein complexes that contain a functional RNA (e.g., snRNP complexes involved in RNA splicing), it has been shown that antisense polynucleotides can inhibit in vitro activity (e.g., splicing). Antisense polynucleotides can be DNA or RNA. They can be chemically modified so as to improve stability in the body. Properties of the polynucleotide can be engineered to impart stability (e.g., nuclease resistance), tighter binding or the desired Tm. For example, the polynucleotide can include modified nucleotide analogs, such as those already described. The polynucleotide can comprise mixtures of naturally occurring nucleotides and nucleotide analogues. Other techniques for rendering polynucleotides nuclease-resistant include those described in International patent publication No. 94/12633. The general approach to constructing various polynucleotides useful in inhibitory polynucleotide therapy has been reviewed by A. R. Vander Krol et al. (1988), Biolechniques 6:958-976, and by C. A. Stein et al., (1988) Cancer Res. (1988) 48:2659-2668. See also Oligodeoxynucleotides: Antisense Inhibitors of Gene Expression, Cohen, J. S., editor, MacMillan Press, London, pages 79-196 (1989), and Antisense RNA and DNA, (1988), D. A. Melton, Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. In certain embodiments inhibitory polynucleotides comprise a derivatized substituent which is substantially non-interfering with respect to hybridization of the inhibitory polynucleotide to the target polynucleotide. Typically such inhibitory polynucleotides are derivatized, and additional chemical substituents are attached, either during or after polynucleotide synthesis, respectively, and are thus localized to a complementary sequence in the target polynucleotide where they produce an alteration or chemical modification to a local DNA sequence and/or to a protein component. Preferred attached chemical substituents include: europium (III) texaphyrin, cross-linking agents, psoralen, metal chelates (e.g., iron/EDTA chelate for iron catalyzed cleavage), topoisomerases, endonucleases, exonucleases, ligases, phosphodiesterases, photodynamic porphyrins, chemotherapeutic drugs (e.g., adriamycin, doxirubicin), intercalating agents, base-modification agents, immunoglobulin chains, and oligonucleotides. Iron/EDTA chelates are particularly preferred chemical substituents where local cleavage of a polynucleotide sequence is desired (Hertzberg et al. (1982) J. Am. Chem. Soc. 104:313; Hertzberg and Dervan (1984) Biochemistry 23:3934; Taylor et al. (1984) Tetrahedron 40:457; P. B. Dervan (1986) Science 232:464). Preferred attachment chemistries include: direct linkage, e.g., via an appended reactive arnino group (Corey and Schultz (1988) Science 238:1401) and other direct linkage chemistries, although streptavidin/biotin and digoxigenin/anti-digoxigenin antibody linkage methods may also be used. Methods for linking chemical substituents are provided in U.S. Pat. Nos. 5,135,720, 5,093,245, and 5,055,556. Other linkage chemistries may be used at the discretion of the practitioner. B. Antisense This invention provides antisense polynucleotides capable of specifically hybridizing to a target sequence of prothymosin, e.g., prothymosin. Antisense polynucleotides are useful in vitro or in vivo to inhibit the activity of prothymosin. The antisense polynucleotides of this invention comprise an antisense sequence of at least 7 nucleotides that specifically hybridize to a sequence from prothymosin and, more particularly, mammalian prothymosin and human prothymosin. In one aspect of the invention, the RNA sequence to which the antisense sequence specifically hybridizes to a coding or non-coding region of the prothymosin gene or mRNA. The antisense sequence can be between about 10 and about 50 nucleotides or between about 15 and about 35 nucleotides. In one embodiment, the sequence of the polypeptide contains within it the antisense sequence. In this case, the antisense sequence is contained within a polynucleotide of longer sequence. In another embodiment, the sequence of the polypeptide consists essentially of, or is, the antisense sequence. Thus, for example, the antisense polynucleotide can be a polynucleotide of less than about 50 nucleotides in a sequence that specifically hybridizes to the target sequence. Generally, to assure specific hybridization, the antisense sequence is substantially complementary to the target sequence in prothymosin. In certain embodiments, the antisense sequence is exactly complementary to the target sequence. The antisense polynucleotides may include nucleotide substitutions, additions, deletions, or transpositions, so long as specific binding to the relevant target sequence corresponding to prothymosin or its gene is retained as a functional property of the polynucleotide. The antisense polynucleotide should be long enough to form a stable duplex but short enough, depending on the mode of delivery, to administer in vivo, if desired. The minimum length of a polynucleotide required for specific hybridization to a target sequence depends on several factors, such as G/C content, positioning of mismatched bases (if any), degree of uniqueness of the sequence as compared to the population of target polynucleotides, and chemical nature of the polynucleotide (e.g., methylphosphonate backbone, polyamide nucleic acid, phosphorothioate, etc.), among others. Antisense polynucleotides of the invention are polynucleotides of at least 7 nucleotides and can be between about 10 and 50 nucleotides or between about 15 and 30 nucleotides. In other embodiments, antisense polynucleotides are polynucleotides of less than about 100 nucleotides or less than about 200 nucleotides. Accordingly, a sequence of the antisense polynucleotide can specifically hybridize to all or part of the prothymosin sequence, such as antisense polynucleotides to the human prothymosin gene or its transcribed RNA, including truncated forms which may be associated with prothymosin ribonucleoprotein. For general methods relating to antisense polynucleotides, see Antisense RNA and DNA, (1988), D. A. Melton, Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). For a review of antisense therapy, see, e.g., Uhlnann et al., Chem. Reviews, 90:543-584 (1990). The formation of a double-stranded polynucleotide resulting from hybridization of an antisense DNA molecule to prothymosin renders prothymosin susceptible to RNase H cleavage. Accordingly, antisense polynucleotides directed against prothymosin are particularly effective for inhibiting prothymosin activity in cells or samples containing RNase H. C. Ribozymes Cleavage of prothymosin can be induced by the use of ribozymes or catalytic RNA. In this approach, the ribozyme would contain either naturally occurring RNA (ribozymes) or synthetic nucleic acids with catalytic activity. Bratty et al., (1992) Biochim. Biophys. Acta., 1216:345-59 (1993) and Denhardt, (1992) Ann. N.Y. Acad. Sci., 660:70-76 describe methods for making ribozymes. Unlike the antisense and other polynucleotides described above, which bind to an RNA, a DNA, or a prothymosin protein component, a ribozyme not only binds but also specifically cleaves and thereby potentially inactivates a target RNA. Such a ribozyme can comprise 5'- and 3'-terminal sequences complementary to the prothymosin RNA. Depending on the site of cleavage, a ribozyme can render the prothymosin enzyme inactive. Upon review of the RNA sequence of the human prothymosin those in the art will note that several useful ribozyme target sites are present and susceptible to cleavage by, for example, a hammerhead motif ribozyme. Optimum target sites for ribozyme-mediated inhibition of prothymosin activity can be determined as described by Sullivan et al., PCT patent publication No. 94/02595 and Draper et al., PCT patent publication No. 93/23569. As described by Hu et al., PCT patent publication No. 94/03596, antisense and ribozyme functions can be combined in a single polynucleotide. Such engineered ribozymes can be expressed in cells or can be transferred by a variety of means (e.g., liposomes, immunoliposomes, biolistics, direct uptake into cells, etc.). Other forms of ribozymes (group I intron ribozymes (Cech (1995) Biotechnology 13; 323); hammerhead ribozymes (Edgington (1992) Biotechnology 10: 256) can be engineered on the basis of the disclosed prothymosin sequence information to catalyze cleavage of prothymosin. D. Other Inhibitory Polynucleotides In addition to the antisense and ribozyme inhibitory polynucleotides, one can construct polynucleotides that will bind to duplex nucleic acid either in the folded. RNA or in the gene for the RNA, forming a triple helix-containing or triplex nucleic acid to inhibit prothymosin activity. Such polynucleotides of the invention are constructed using the base-pairing rules of triple helix formation and the nucleotide sequence of target gene. (Cheng et al. (1988) J. Biol. Chem. 263: 15110; Ferrin and Camerini-Otero (1991) Science 354: 1494; Ramdas et al. (1989) J. Biol. Chem. 264: 17395; Strobel et al. (1991) Science 254: 1639; Hsieh et al. (1990) op.cit.; Rigas et al. (1986) Proc. Natl. Acad. Sci. (U.S.A.) 83: 9591.) Such polynucleotides can block prothymosin activity in a number of ways, including by preventing transcription of the prothymosin gene. Typically, and depending on mode of action, the triplex-forming polynucleotides of the invention comprise a sequence large enough to form a stable triple helix but small enough, depending on the mode of delivery, to administer in vivo. E. Methods of Making Inhibitory Polynucleotides Inhibitory polynucleotides can be made chemically or recombinantly. 1. Chemical synthesis Small inhibitory polynucleotides for direct delivery can be made by chemical synthesis. Chemically synthesized polynucleotides can be DNA or RNA, or can include nucleotide analogs or backbones that are not limited to phosphodiester linkages. 2. Recombinant production For delivery into cells or for gene therapy methods, recombinant production of inhibitory polynucleotides through the use of expression vectors is particularly useful. Accordingly, this invention also provides expression vectors, e.g., recombinant nucleic acid molecules comprising expression control sequences operatively linked to the nucleotide sequence encoding the inhibitory polynucleotide. Expression vectors can be adapted for function in prokaryotes or eukaryotes (e.g., bacterial, mammalian, yeast, Aspergillus, and insect cells) by inclusion of appropriate promoters, replication sequences, markers, etc. for transcription and translation of mRNA. The construction of expression vectors and the expression of genes in transfected cells involves the use of molecular cloning techniques also well known in the art. Sambrook et al., Molecular Cloning--A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989), Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., (Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.) and Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques (1987), Academic Press, Inc., San Diego, Calif. Useful promoters for such purposes include a metallothionein promoter, a constitutive adenovirus major late promoter, a dexamethasone-inducible MMTV promoter, a SV40 promoter, a MRP polII promoter, a constitutive MPSV promoter, a tetracycline-inducible CMV promoter (such as the human immediate-early CMV promoter), and a constitutive CMV promoter. A plasmid useful for gene therapy can comprise other functional elements, such as selectable markers, identification regions, and other genes. Recombinant DNA expression plasmids can also be used to prepare the polynucleotides of the invention for delivery by means other than by gene therapy, although it may be more economical to make short oligonucleotides by in vitro chemical synthesis. Methods of transfecting genes into mammalian cells and obtaining their expression for in vitro use or for gene therapy, are well known to the art. See, e.g., Methods in Enzymology, vol. 185, Academic Press, Inc., San Diego, Calif. (D. V. Goeddel, ed.) (1990) or M. Krieger, Gene Transfer and Expression--A Laboratory Manual, Stockton Press, New York, N.Y., (1990). Cells can be transfected with plasmid vectors, for example, by electroporation. Cells can be transfected by polynucleotides by calcium phosphate precipitation DNA liposome complexes, by particle-mediated gene transfer (biolistics) or with liposomes. Expression vectors useful in this invention depend on their intended use. Such expression vectors must, of course, contain expression and replication signals compatible with the host cell. Expression vectors useful for expressing the inhibitory polynucleotide of this invention include viral vectors such as retroviruses, adenoviruses and adeno-associated viruses, plasmid vectors, cosmids, liposomes and the like. Viral and plasmid vectors are preferred for transfecting mammalian cells. The expression vector pcDNA1 (Invitrogen, San Diego, Calif.), in which the expression control sequence comprises the CMV promoter, provides good rates of transection and expression. Adeno-associated viral vectors are useful in the gene therapy methods of this invention. F. In Cells Inhibitory polynucleotides against prothymosin are useful for inhibiting prothymosin activity in both cultured cells and in cells in vivo. The inhibition of prothymosin activity in cells in vivo is useful in prophylactic and therapeutic methods of treating endometriosis. This invention contemplates a variety of means for delivering an inhibitory polynucleotide to a subject including, for example, direct uptake of the molecule by a cell from solution, facilitated uptake through lipofection (e.g., liposomes or immunoliposomes), particle-mediated transfection, and intracellular expression from an expression cassette having an expression control sequence operably linked to a nucleotide sequence that encodes the inhibitory nucleic acid. One can provide a cell with an inhibitory polynucleotide by contacting the cell with a soluble inhibitory nucleic acid, for example, in the culture medium in vitro or in the circulatory system, interstitial fluid or tissue mass in vivo. Soluble inhibitory nucleic acids present in the external milieu have been shown to gain access to the cytoplasm. Methods useful for delivery of polynucleotides for therapeutic purposes are described in Inouye et al., U.S. Pat. No. 5,272,065. VI. Methods of Inhibiting Prothymosin Expression This invention provides methods of inhibiting prothymosin activity in endometrial cells either in vitro, ex vivo or in vivo. The methods involve contacting the cells with an agent that inhibits prothymosin expression. The agent can be any compound or composition that inhibits prothymosin expression, including inhibitory polynucleotide, small molecules and prothymosin ligands, such as an antibody that specifically binds prothymosin, thereby inhibiting its activity. Inhibiting prothymosin in endometrial cells in vitro is useful in inhibiting cell proliferation. Inhibiting prothymosin in vivo is useful as a therapy against endometriosis. VII. Prophylactic and Therapeutic Methods This invention provides methods of inhibiting prothymosin expression for treating endometriosis. The methods involve administering to the subject an agent (e.g., a compound) that inhibits expression of prothymosin in an amount effective to inhibit prothymosin activity (a "pharmacologically effective amount"). Cells that express prothymosin activity and that can be targets of prothymosin inhibition therapy include eutopic and ectopic endometrial cells. Such agents include small molecules, inhibitory polynucleotides, or antibodies or other ligands than bind prothymosin polypeptides. A. Administration Inhibitory compounds can be delivered conveniently in the form of a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a pharmacologically effective amount of the agent. The pharmaceutical composition can be administered by any means known in the art for delivery of such molecules. However, systemic administration by injection is preferred. Because endometriotic lesions occur in the peritoneum, most preferably, this is intraperitoneal administration. However, other systemic routes of administration include intramuscular, intravenous, and subcutaneous injection. The pharmaceutical compositions can be administered in a variety of unit dosage forms depending upon the method of administration. For example, unit dosage forms for parenteral administration include unit doses of injectable solutions. The form, amounts and timing of administration generally are a matter for determination by the practitioner. In one embodiment, the pharmaceutical composition is delivered as a unit dosage form. In the case of polynucleotides or vectors used in gene therapy, doses can be escalated until an optimal dose is determined. Dosages of about of to 1013 particles of viral vector per ml of carrier are effective. Systemic administration can be from about 0.1 mg/kg to about 2.0 mg/kg per day. However, when delivered directly to the site (e.g., peritoneum) the amount can be less. The volume administered can be selected by the practitioner. According to one embodiment of this invention, approximately 1010 vectors suspended in about 1 ml of sterile PBS constitute a therapeutically effective amount. Claim 1 of 32 Claims What is claimed is: 1. A method for use in the diagnosis of endometriosis in a subject comprising the steps of: detecting a test amount of a prothymosin gene product in a sample from the subject; and comparing the test amount with a normal amount of the prothymosin gene product in a control sample, whereby a test amount above the normal amount provides a positive indication in the diagnosis of endometriosis.
____________________________________________
|
|
|