|
|
|
|
|
|
Title: Peptides for inhibition of herpes simplex virus entry United States Patent: 6,699,481 Issued: March 2, 2004 Inventors: Lambris; John D. (Bryn Mawr, PA); Sarrias; Maria Rosa (Philadelphia, PA); Cohen; Gary H. (Havertown, PA); Eisenberg; Roselyn J. (Haddonfield, NJ); Spear; Patricia G. (Chicago, IL); Montgomery; Rebecca I. (Lodi, WI) Assignee: The Trustees of the University of Pennsylvania (Philadelphia, PA); Northwestern University (Evanston, IL) Appl. No.: 784887 Filed: February 16, 2001 Abstract The invention includes antiherpesviral peptides and method of generating the same. BRIEF SUMMARY OF THE INVENTION The invention relates to cyclic peptides that bind with HveA and inhibit interaction of HveA with its ligands. Binding of HveA with one or more of the peptides inhibits interaction of the receptor with HSV gD such that virus entry into cells is inhibited. Furthermore, binding of HveA with one or more of the peptides inhibits HveA interaction with LT-.alpha.. Thus, the invention includes a cyclic peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof, wherein the peptide is capable of binding with HveA. In one aspect, the peptide inhibits binding of herpes simplex virus gD with HveA. In another aspect, the peptide is BP-1 and it inhibits binding of lymphotoxin-alpha (LT-.alpha.) with HveA. In a further aspect, the peptide inhibits entry of a HSV e.g. HSV-1 or HSV-2, into a cell. The invention also includes an isolated nucleic acid encoding a cyclic peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof, wherein the peptide binds HveA. In one aspect, the peptide inhibits binding of HSV gD with HveA. In another aspect, the peptide is BP-1, and the peptide inhibits binding of LT-.alpha. with HveA. The invention further includes a method of inhibiting the ability of HveA to bind with HSV gD. The method comprises contacting HveA with a peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof. In one aspect, the peptide is added to a preparation of HSV gD and HveA. The invention includes a method of inhibiting entry of an HSV into a cell. The method comprises contacting a cell with a peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof. The peptide binds with cellular HveA and inhibits binding of HSV gD with cellular HveA, thereby inhibiting entry of the HSV into the cell. In one aspect, the cell is contacted with the peptide in the presence of HSV gD. The invention also includes a method of inhibiting replication of an HSV. The method comprises contacting a cell with a peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof. The peptide binds with cellular HveA, thereby inhibiting binding of HSV gD with the HveA and inhibiting replication of the HSV. In one aspect, the cell is contacted with the peptide in the presence of HSV gD. The invention includes a method of treating a human infected with an HSV. The method comprises administering to the human a peptide in a pharmaceutically acceptable carrier. The peptide is selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof. The peptide binds with HveA thereby treating the human infected with the HSV. The invention also includes a method of producing a cyclic peptide which affects interaction between HSV gD and an HSV receptor protein which binds gD. The method comprises (a) preparing a random peptide phage display library; (b) selecting phage that bind to either of HSV gD and HveA; (c) isolating the phage; and (d) isolating the peptide from the isolated phage. A peptide which affects the interaction between HSV gD and the HSV receptor proteins is thereby provided. The invention further includes a cyclic peptide produced by this method. In one aspect, the HSV receptor protein is selected from the group consisting of HveA, HveB, and HveC. The invention further includes a cyclic peptide selected from the group consisting of BP-1, a fragment thereof, and a variant thereof, wherein the peptide binds with HveA. The peptide also inhibits binding of LT-.alpha. with HveA. The invention also includes a method of inhibiting binding of HveA with LT-.alpha.. This method comprises combining a peptide and a preparation of LT-.alpha. and HveA. The peptide is selected from the group consisting of BP-1, a fragment thereof, and a variant thereof. The peptide binds with at least one of LT-.alpha. and Hve A and inhibits binding of HveA with LT-.alpha.. The invention includes another method of inhibiting binding of HveA with LT-.alpha.. This method comprises contacting HveA with a peptide selected from the group consisting of BP-1, a fragment thereof, and a variant thereof. The peptide binds with HveA, and inhibits binding of HveA with LT-.alpha.. The invention includes a method of producing a cyclic peptide which affects interaction between LT-.alpha. and HveA. The method comprises (a) preparing a random peptide phage display library; (b) selecting a phage that binds with at least one of LT-.alpha. and HveA; (c) isolating the phage; and (d) producing a cyclic peptide from the isolated phage, thereby producing a cyclic peptide which affects interaction between LT-.alpha. and HveA. The invention also includes a method of determining whether a test compound affects HSV gD binding with HveA. According to this method, a first preparation is made comprising a surface having at least a portion of HveA bound thereon, the test compound, and a suspension of a phage in contact with the surface. The phage displays a cyclic peptide selected from the group consisting of BP-1 and BP-2, and mutants, homologs, derivatives, and variants of BP-1 and BP-2. The amount of phage bound with the surface in the first preparation is assessed. This amount is compared with the amount of phage bound with the surface in an otherwise identical preparation to which the test compound is not added. A difference between the amount of phage bound with the surface in the first preparation with the otherwise identical preparation is an indication that the test compound affects the binding of gD with HveA. In one aspect, the amount of phage bound with the surface is assessed using an antibody that specifically binds with the phage. The invention includes another method of determining whether a test compound affects HSV gD binding with HveA. According to this method, a first preparation is made comprising a surface having at least a portion of HveA bound thereon, the test compound, and a cyclic peptide selected from the group consisting of BP-1 and BP-2, and mutants, homologs, derivatives, and variants of BP-1 and BP-2, in contact with the surface. The amount of the peptide bound with the surface in the first preparation is assessed. This amount is compared with the amount of the peptide bound with the surface in an otherwise identical preparation to which the test compound is not added. A difference between the amount of peptide bound with the surface in the first preparation with the otherwise identical preparation is an indication that the test compound affects the binding of gD with HveA. The invention also includes a method of determining whether a test compound affects LT-.alpha. binding with HveA. According to this method, a first preparation is made comprising a surface having at least a portion of HveA bound thereon, the test compound, and a suspension of a phage in contact with the surface. The phage displays BP-1. The amount of phage bound with the surface in the first preparation is assessed. This amount is compared with the amount of phage bound with the surface in an otherwise identical preparation to which the test compound is not added. A difference between the amount of phage bound with the surface in the first preparation with the otherwise identical preparation is an indication that the test compound affects the binding of LT-.alpha. with HveA. The invention includes another method of determining whether a test compound affects LT-.alpha. binding with HveA. According to this method, a first preparation is made comprising a surface having at least a portion of HveA bound thereon, the test compound, and a BP-1 peptide in contact with the surface. The amount of the BP-1 peptide bound with the surface in the first preparation is assessed. This amount is compared with the amount of the BP-1 peptide bound with the surface in an otherwise identical preparation to which the test compound is not added. A difference between the amount of BP-1 peptide bound with the surface in the first preparation with the otherwise identical preparation is an indication that the test compound affects the binding of LT-.alpha. with HveA. In one aspect, the BP-1 peptide is labeled. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to two cyclic HveA-binding peptides (herein designated BP-1 and BP-2) which affect interaction of cellular HveA with herpes simplex virus gD and which, in turn, can inhibit HSV entry into cells. As more fully set forth below, HveA was used to screen two phage-displayed random peptide libraries. The structures of these two cyclic peptides are depicted in FIG. 2. BP-1 and BP-2 bind with HveA and distinctly inhibit the binding-of herpes simplex virus (HSV) glycoprotein D (gD) with HveA. Moreover, BP-2 blocks HSV entry into HveA-expressing cells. It has been discovered that the cyclic peptides of the invention (i.e., BP-1 and BP-2) affect interaction of HveA with its ligands. For instance, BP-2 inhibits HveA binding with HSV gD. BP-1 inhibits HSV gD binding with HveA to a lesser extent than BP-2. BP-1 also inhibits LT-.alpha. binding with HveA; BP-2 has no detectable effect on HveA/LT-.alpha. interaction. The cyclic peptides of the invention therefore are useful for inhibiting HSV entry into cells and also are useful for development of additional compositions (e.g. mutants, homologs, derivatives, and variants of the cyclic peptides of the invention and nucleic acids encoding them) which block the interaction between HveA, its natural ligands, and virus specific protein(s) involved in HSV entry into cells. Thus, the invention provides novel compositions and methods of antiviral therapy, immunomodulation, or both. BP-1 is a cyclic 26-residue peptide that inhibits binding of gD with HveA. BP-1 also blocks binding of HveA with one of its natural ligands, LT-.alpha.. Moreover, preventing disulfide bond formation by blocking the cysteine groups of BP-1 using an acetamidomethyl (Acm) group, i.e., thereby producing BP-1 (4, 10 Acm), destroyed the ability of BP-1 to inhibit binding of HveA with HSV gD or with LT-.alpha.. BP-2 is a cyclic 12-residue peptide that inhibits binding of HSV gD with HveA and which blocks HSV entry into CHO-HveA cells. Unlike BP-1, BP-2 does not inhibit HveA binding to LT-.alpha.. However, linearization of BP-2 (e.g., by alanine substitution of the two cysteine residues of BP-2 to yield BP-2 (3, 9 Ala), abrogates the ability of BP-2 to bind HveA or to inhibit gD binding with HveA. These results suggest that BP-1 and BP-2 interact with HveA to block HSV entry into CHO-HveA cells and to affect the host immune response to HSV infection mediated by binding of LT-.alpha. with HveA. Therefore, these peptides, as well as mutants, homologs, derivatives, and variants of these peptides, are important therapeutics to combat herpesvirus infection and to inhibit disorders associated with aberrant cytokine activity of LT-.alpha.. The invention includes a cyclic peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof, which binds with cellular HveA, thereby disrupting binding of HSV gD with cellular HveA, an important mediator of HSV entry into cells. The peptides of the invention are useful for inhibiting entry of HSV into cells and are therefore useful anti-herpesvirus therapeutic compounds, as are the mutants, homologs, derivatives, and variants thereof. The invention includes inhibition of entry of HSV-1 and HSV-2 into cells and also includes inhibition of entry of other alpha-herpesviruses into cells using other peptides generated by following the protocols disclosed herein. Preferably, the virus the entry of which into cells is inhibited is HSV-1. The cyclic peptides of the invention block, inter alia, the interactions between an HSV gD, and a host cell protein, HveA. However, the invention is not limited to HSV gD as the ligand or to HveA as the receptor. Instead, the invention encompasses other ligand and receptor combinations that interact with the peptides of the invention in a similar manner to the interaction of HveA with the cyclic peptides of the invention. Other cell receptors having homology with HveA also bind BP-1, BP-2, or both, such that the cyclic peptides of the invention abrogate binding of ligands with such receptors. Therefore, the present invention includes inhibition of ligand/receptor interactions involving receptors which are homologous with HveA. Once homology between HveA and a putative TNFR-like protein is established (e g., by searching DNA or protein databases such as GenBank or SwissProt), the methods disclosed herein are used to determine whether a cyclic peptide of the invention inhibits binding of the homologous receptor and its ligand(s). A TNFR family member having substantial homology with HveA was recently identified by Benedict et al. (1999, J. Immunol. 162:6967-6970). Benedict et al., identified a non-cellular structural homolog of HveA encoded by the UL144 open reading frame of human cytomegalovirus (HCMV). ClustalW analysis of amino acid sequence homology indicated 46% homology between HveA and HCMV UL144. The cyclic peptides of the invention can also inhibit UL144 interaction(s) with various ligands, which interactions can be required for one or more of virus (e.g., HCMV) entry, immune evasion, blockade of apoptosis, and maintenance and spread of virus infection. Therefore, the cyclic peptides of the invention are useful therapeutics to treat and inhibit infection by pathogens which interact with one or more members of the TNFR superfamily (e.g., Fas, TNFR-1, LT.beta.R, or TRAIL-R2) or TNF-related ligands (e.g., TRAIL, LIGHT, LT-.alpha., LT-.alpha.1.beta.2, TNF, FasL, CD40L, CD30L, Tweak, 41BBL, OX40L, April, RankL, or TL1). The invention includes a cyclic peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants thereof. Preferably, the amino acid sequence of the isolated peptide is at least about 50% homologous to the amino acid sequence of at least one of BP-1 (SEQ ID NO:4) and BP-2 (SEQ ID NO:5). More preferably, the isolated peptide is at least about 60%, 70%, 80%, 90%, 95%, or 99% homologous with at least one of the amino acid sequences of BP-1 (SEQ ID NO:4) and BP-2 (SEQ ID NO:5). More preferably, the isolated peptide is one of BP-1 and BP-2. It is not necessary that the cyclic peptide of the invention comprise the full complement of amino acids recited above. Rather the peptide of the invention may comprise less than the full length of either of the peptides recited above. For example, the peptide may comprise about five amino acids, preferably about ten amino acids and, even more preferably about twelve or more amino acids in length. It is merely necessary that the peptide be capable of disrupting the interaction of HSV gD with HveA or LT-.alpha. in one of the assays provided herein. The cyclic peptides of the invention can have at least one amino acid residue at either one or both ends. For example, the peptides can have 1, 2, 3, 4, 5, 10, or 20, or more amino acid residues at either the amino or carboxyl terminus, or at both termini. The cyclic peptides of the invention can be obtained by any suitable means including, but not limited to, synthetic means, recombinant means, biochemical means, and the like. The generation of peptides is well known in the art and is described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1993, Current Protocols in Molecular Biology, Green & Wiley, New York). The invention includes a nucleic acid encoding a cyclic peptide of the invention. Such nucleic acid can also be obtained by any suitable means, including, but not limited to, synthetic means and recombinant means. In one embodiment, a nucleic acid encoding BP-1 has the nucleic acid sequence 5'-TCTATTTCCTGCTCTAGGGGGTTAGTTTGCCTCTTACCGCGATTGACTAA CGAGTCCGGTAATGATAGGTTCGACTCT-3' (SEQ ID NO:7), and a nucleic acid encoding BP-2 has the nucleic acid sequence 5'-GGGTCGTGTGATGGGTTTAGGGTGTGTTATATGCAT-3' (SEQ ID NO:8). However, the nucleic acid of the present invention is not limited to these nucleic acid sequences. Instead, the present invention includes any nucleic acid sequence encoding BP-1, BP-2, or a mutant, homolog, derivative, or variant thereof. Generation of, for example, DNA encoding specific peptides is well known in the art and is described, for example, in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and in Ausubel et al. (1993, Current Protocols in Molecular Biology, Green & Wiley, New York). DNA encoding a cyclic peptide of the invention may be cloned and expressed in any suitable expression vector and may further be operably linked to any suitable promoter/regulatory sequence in order that the DNA is expressed in a desired cell. Upon reading the present disclosure, the skilled artisan is able to generate mutants, homologs, derivatives, and variants of the cyclic peptides of the invention, or of DNA encoding the same, which peptides have the property of binding to cellular HveA, and disrupting binding of HSV gD with cellular HveA. Such technology is also described in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and in Ausubel et al. (1993, Current Protocols in Molecular Biology, Green & Wiley, New York). Homologs of the peptides of the invention are peptides which share significant amino acid sequence homology with BP-1 and BP-2, and which have the property of binding with cellular HveA. Such homologs can disrupt binding of HSV gD, LT-.alpha., or both, with HveA. In another aspect, the present invention includes a nucleic acid encoding a cyclic peptide wherein the peptide encoded by the nucleic acid has at least about 50% amino acid sequence homology with BP-1 or with BP-2. Preferably, the peptide encoded by the nucleic acid is about 60%, 70%, 80%, 90%, 95%, or 99% homologous with BP-1 or BP-2. More preferably, the peptide encoded by the nucleic acid is BP-1 or BP-2. "Mutants," "derivatives," and "variants" of the cyclic peptides of the invention (or of the DNA encoding the same) are cyclic peptides which are altered at one or more amino acid residues (or at one or more nucleotide residues) such that the peptide (or nucleic acid) is not identical to the sequences corresponding to BP-1 or BP-2 recited herein, but has the same property as the peptides disclosed herein, in that the peptide has the property of binding to cellular HveA. Derivatives may, for example, have substituent moieties pending from one or more amino acid residues. The peptides of the invention can be isolated or even substantially pure. A substantially pure peptide can be purified using known procedures for protein purification, wherein an immunological, enzymatic, or other assay is used to monitor purification at each stage in the procedure. Protein purification methods are well known in the art, and are described, for example in Deutscher et al. (ed., 1990, Guide to Protein Purification, Harcourt Brace Jovanovich, San Diego). The present invention also provides for variants of the peptides of cyclic the invention. Variants can differ from BP-1 or BP-2 by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both. For example, conservative amino acid changes may be made, which although they alter the primary sequence of the peptide, do not alter its function. Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine. Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of peptides, e.g., acetylation or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a peptide during its synthesis and processing or in further processing steps; e.g., by exposing the peptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine. Also included are cyclic peptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such peptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The cyclic peptides of the invention are not limited to products of any of the specific exemplary processes listed herein. The invention includes a method of inhibiting entry of HSV into a cell. Interaction between HSV gD and a cellular HveA receptor is required for virus entry into the susceptible cell. Inhibiting this interaction inhibits entry of the virus into the cell. Further, the present invention includes a method of inhibiting replication of HSV. This is because, inhibition of entry of HSV into a cell necessarily prevents virus replication which requires entry of HSV into the host cell. In addition, the invention includes a method of treating a human infected with HSV. HveA is involved not only in initial entry of HSV into a cell (i.e., to initiate infection), but is also involved in the cell-to-cell spread of HSV infection. Inhibition of interaction of gD with HveA inhibits virus entry, as well as virus spread from infected cells to adjacent uninfected cells. Inhibition of virus entry and of cell-to-cell spread is an effective treatment for virus infection, preventing infection and decreasing the rate, the magnitude, or both, of infection. The method comprises administering to a human (e.g., a human infected with an HSV) a cyclic peptide of the invention, or a nucleic acid encoding the same. The cyclic peptide or nucleic acid encoding the peptide can be suspended in a pharmaceutically acceptable carrier. The invention also includes a method of generating peptidometics and small molecules which are based upon the sequence of the two peptides exemplified herein (i.e., BP-1 and BP-2), which peptidometics and small molecules have the property of binding to cellular HveA and disrupting binding of HSV gD with HveA. Generation of peptidometics can be accomplished using techniques described in PCT/US93/01201 and in U.S. Pat. No. 5,334,702, for example. Generation of small molecules can be accomplished by first identifying contact points between a cyclic peptide of the invention and HveA and then synthesizing small molecules which are specifically designed to mimic binding of the peptide with HveA. The invention also includes a method of producing a cyclic peptide and nucleic acid encoding the same. The cyclic peptide has the property of binding with HveA and affecting interaction of gD and HveA. The method comprises preparing a random peptide phage display library, binding one or more of the phage with either of gD and HveA (e.g., gD or HveA bound at a surface), isolating phage which so bind and isolating DNA or peptide from those phage. In this manner, the cyclic peptide is produced. The cyclic peptide has the property of binding to cellular HveA, thus affecting interaction of gD and cellular HveA. Nucleic acid encoding the peptide displayed by a phage of the library is contained within the phage. Thus, both the peptide and a nucleic acid encoding it can be co-isolated. The invention further includes a method of producing a cyclic peptide and a DNA encoding it. The peptide is capable of disrupting binding of gD with cellular virus receptor proteins, such as, but not limited to, HveB and HveC. This method of the invention is performed in a similar manner to that described above, substituting the desired cellular virus receptor protein in place of HveA. The invention also includes a method of producing a cyclic peptide and a nucleic acid encoding the same. The cyclic peptide has the property of binding with HveA and disrupting binding of LT-.alpha. with HveA (e.g., on a cell surface). The method comprises preparing a random peptide phage display library, binding the phage with either of LT-.alpha. or HveA (e.g., on a surface), isolating phage which so bind, and isolating DNA or peptide from phage which bind. A peptide and a DNA molecule encoding it are produced. Also included in the invention is a method of inhibiting interaction of HSV gD with cellular HveA. This method comprises contacting a cyclic peptide selected from the group consisting of BP-1, BP-2, and mutants, homologs, derivatives, and variants of either of these, with the cellular HveA. The peptide binds with HveA and disrupts interaction of HveA with gD. In one aspect, the method comprises adding the cyclic peptide to a preparation comprising both HSV gD and cellular HveA. The peptide binds with HveA and disrupts interaction of gD with HveA. For example, the preparation may comprise an HSV having gD on the surface thereof (e.g., HSV-1 or HSV-2) and a cell having HveA on its surface. The HSV is capable of infecting the cell. However, if a cyclic peptide of the invention is added to the preparation, then the virus is no longer able to infect the cell because the peptide inhibits binding of HSV gD with cellular HveA, thereby inhibiting entry of the HSV into the cell. The present invention is not limited to adding the peptide of the invention to a preparation in which both HveA and gD are present. Addition of a cyclic peptide of the invention to any preparation comprising HveA causes the peptide to bind with HveA such that binding between HveA and gD is inhibited. Also included in the invention is a method of inhibiting the interaction of LT-.alpha. with HveA (e.g. HveA on the surface of a cell). This method comprises combining a cyclic peptide of the invention with a preparation comprising HveA. The cyclic peptide of the invention binds with HveA and inhibits interaction between HveA and LT-.alpha., regardless of whether HveA and LT-.alpha. are bound at the time. The present invention is not limited to addition of the peptide of the invention to preparations comprising both HveA and LT-.alpha.. The peptide can be combined with HveA either before, during, or after interaction between HveA and LT-.alpha. has occurred. The invention includes a method of treating a human having an HSV infection. The method comprises administering to the human a cyclic peptide of the invention, or a nucleic acid encoding a cyclic peptide of the invention (e.g., a nucleic acid contained in a vector). The peptide or nucleic acid can be suspended in a pharmaceutically acceptable carrier. Administration of peptides and/or nucleic acids to humans is well known in the art and formulations and preparations for such administration and dosages of the same are within the ken of the ordinarily skilled artisan. The invention encompasses use of pharmaceutical compositions comprising a cyclic peptide of the invention, a nucleic acid encoding a cyclic peptide of the invention, or both, suspended in a pharmaceutically-acceptable carrier. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of peptide, nucleic acid, or nucleic acid vector between 1 nanogram per kilogram per day and 100 milligrams per kilogram per day. Pharmaceutical compositions that are useful in the methods of the invention may be administered systemically in oral solid formulations, ophthalmic, suppository, aerosol, topical, or other similar formulations. In addition to the peptide or nucleic acid of the invention, such pharmaceutical compositions can contain pharmaceutically-acceptable carriers and other ingredients known to enhance and facilitate drug administration. Other possible formulations, such as nanoparticles, liposomes, resealed erythrocytes, and immunologically based systems may also be used to administer the nucleic acid or peptide according to the methods of the invention. The invention includes a method of identifying a test compound that affects HSV gD binding with HveA. The method comprises making a first preparation comprising HveA, the test compound, and at least one phage displaying a peptide capable of inhibiting binding of gD with HveA such as, but not limited to, BP-1 and BP-2. The phage or HveA may be bound at a surface. Binding of HveA with the phage in the first preparation is compared with binding of HveA with phage in an otherwise identical preparation which does not contain the test compound. Binding of the phage with HveA can, for example, be determined as disclosed herein; that is, HveA immobilized on a surface is incubated with phage and phage bound to the surface are detected using an antibody which binds specifically with the phage including, but not limited to, an antibody which binds specifically with bacteriophage M13. Such antibody can be labeled antibody or can be detected using a labeled secondary antibody. A difference between the amount of phage bound with HveA in the first preparation and the amount of phage bound with HveA in the otherwise identical preparation is an indication that the test compound affects gD binding with HveA. HveA can be immobilized on a solid support, such as a well of a plastic microtiter plate. Recombinant HveA containing a "tag" epitope may be immobilized on a resin which binds the tag. Such tag epitopes and resins which specifically bind them are well known in the art and include, for example, tag epitopes comprising a plurality of sequential histidine residues, which allows isolation of a chimeric protein comprising such an epitope on nickel-nitrilotriacetic acid-agarose, a hemagglutinin (HA) tag epitope allowing a chimeric protein comprising such an epitope to bind with an anti-HA-monoclonal antibody affinity matrix, a glutathione-S-transferase tag epitope, and a maltose binding protein (MBP) tag epitope, which can induce binding between a protein comprising such an epitope and a glutathione- or maltose-Sepharose column, respectively. Production of proteins comprising such tag epitopes is well known in the art and is described in standard treatises such as Sambrook et al., 1989, and Ausubel et al., supra. The data disclosed herein demonstrate that binding of HveA with phage displaying a cyclic peptide of the invention provides a sensitive system for identifying a compound (e.g., a cyclic peptide) that affects gD binding with HveA. This method can also be used to assess whether a test compound affects binding of gD with HveA. Binding of phage-displayed peptide with HveA correlates with binding of gD with HveA, as the data disclosed herein demonstrate. That is, the phage-displayed peptides disclosed herein were selected for their ability to bind with HveA. Peptides isolated from such phage were able to inhibit gD binding with HveA. Therefore, a substance which affects binding of a phage, or a peptide isolated from a phage, with HveA also affects binding of gD with HveA because binding of the peptide with HveA is analogous to binding of HveA with its natural ligand. The invention also includes a method of identifying a test compound that affects LT-.alpha. binding with HveA. The method comprises making a first preparation comprising HveA (preferably immobilized on a surface), the test compound, and at least one phage displaying a peptide capable of inhibiting binding of LT-.alpha. with HveA. Such peptides include, but are not limited to, cyclic peptides of the invention, such as BP-1. The phage is capable of contacting the surface (e.g., because the surface contacts a phage suspension). The amount of phage bound with the surface in the first preparation (i.e., containing the test compound) is compared with the amount of phage bound with the surface in an otherwise identical preparation which does not contain the test compound. The binding of the phage with the surface may be determined as disclosed herein (e.g., an antibody which specifically binds with the phage). A difference between the amount of phage bound with the surface in the first preparation and in the amount of phage bound with the surface in the otherwise identical preparation is an indication that the test compound affects LT-.alpha. binding with HveA. The data disclosed herein demonstrate that binding of phage displaying BP-1 with HveA provides a sensitive system for identifying a compound (e.g., a cyclic peptide such as a variant BP-1) that affects LT-.alpha. binding with HveA. Binding of phage-displayed peptide with HveA correlates with the binding of LT-.alpha. with HveA, as the data disclosed herein demonstrate. Phage-displayed peptides were selected for their ability to induce binding of the phage with HveA. The peptides isolated from HveA-binding phage were able to inhibit LT-.alpha. binding with HveA. Therefore, a substance which affects binding of a phage displaying BP-1, or binding of BP-1, with HveA affects binding of LT-.alpha. with HveA. This is so because binding of a peptide with HveA is analogous to binding of HveA with LT-.alpha., a natural ligand of HveA. Inhibition of interaction between HveA and LT-.alpha. is useful for preventing, alleviating, and treating various disease conditions associated with interaction of LT-.alpha. and HveA. LT-.alpha. is a cytokine that is involved in autoimmune tissue damage. Therefore, blocking or inhibiting the interaction of LT-.alpha. with HveA can prevent, inhibit, ameliorate, or reverse pathology associated with one or more autoimmune diseases. Indeed, amelioration of autoimnmune disease has been successfully achieved in vivo. Blocking of either TNF or LT-.alpha. using neutralizing antibodies in three animal models of autoimmune disease (i.e., rheumatoid arthritis, experimental autoimmune encephalomyelitis, and experimental autoimmune uveoretinitis) ameliorated the disease. Therefore, BP-1 is useful as a therapeutic in LT-.alpha.-mediated tissue damage in autoimmune diseases, as are mutants, homologs, derivatives, and variants of BP-1. Because BP-2 and its mutants, homologs, derivatives, and variants also interfere with binding between HveA and ligands thereof (e.g., HSVs), these agents are also useful for prevention, inhibition, amelioration, and reversal of HveA-associated diseases. In addition, studies of the in vivo function of LT-.alpha. employing gene targeting technology have demonstrated that LT-.alpha. has a central role in formation of secondary lymphoid organs during development. LT-.alpha. also controls formation of germinal centers necessary for immunoglobulin-isotype switching during immune responses in adults. Soluble LT-.alpha. interacts with two receptors, designated TNFRI and TNFRII, which are expressed in most cell types. Interaction of LT-.alpha. with one or both of these receptors can lead to cellular cytotoxicity, induction of host defense (antiviral and antibacterial) mechanisms, and thymocyte proliferation. Thus, BP-1 is useful as a potential regulator of these physiological processes. Claim 1 of 7 Claims What is claimed is: 1. A peptide selected from the group consisting of SEQ ID NO:4 and SEQ ID NO:5.
____________________________________________
|
|
|