|
|
|
|
|
|
Title: Animal model United States Patent: 6,709,860 Issued: March 23, 2004 Inventors: Enerback; Sven (Molndal, SE); Carlsson; Peter (Floda, SE) Assignee: Biovitrum AB (Stockholm, SE) Appl. No.: 587945 Filed: June 6, 2000 Abstract According to the invention, a major role for the winged helix protein FKHL14/FOXC2 in regulating energy balance and adiposity is demonstrated. The invention relates to transgenic non-human mammalian animals being capable of expressing the human FKHL14/FOXC2 gene in its adipose tissue. The invention also relates to methods for identifying compounds useful for the treatment of medical conditions related to obesity or diabetes, said compounds being capable of stimulating expression of the human FKHL14/FOXC2 gene, or being capable of stimulating the biological activity of a polypeptide encoded by the human FKHL14/FOXC2 gene. The invention further relates to methods for identifying compounds useful for the treatment of medical conditions related to malnutrition, said compounds being capable of decreasing expression of the human FKHL14/FOXC2 gene, or being capable of decreasing the biological activity of a polypeptide encoded by the human FKHL14/FOXC2 gene. DISCLOSURE OF THE INVENTION According to the present invention, the human transcription factor gene FKHL14/FOXC2 is identified as a key regulator of adipocyte metabolism. Increased FKHL14/FOXC2 expression, in white (WAT) and brown adipose tissue (BAT), has a pleiotropic effect on gene expression, which leads to resistance to diet induced weight gain and a decrease in: total body lipid content, serum triglycerides, plasma levels of free fatty acids, glucose and insulin. To our knowledge, FKHL14/FOXC2 is the hitherto only identified gene that, in a concerted action, can counteract most, if not all, of the symptoms associated with obesity, including hypertriglyceridemia and insulin resistance--a likely consequence hereof would be protection against type 2 diabetes. During adulthood, the human winged helix gene FKHL14/FOXC2 is expressed exclusively in adipose tissue. The LPL mRNA levels in the FKHL14/FOXC2 transgenic mice seem to be slightly elevated (FIG. 10), which is in concordance with the initial findings that the two winged helix cis-regulatory elements are responsible for the inducibility of the LPL promoter (Enerback et al., 1992). The higher expression level of LPL most probably is responsible for the significantly decreased plasma TG levels noticed in FKHL14/FOXC2 transgenic mice (FIG. 11), in addition to the fact that the profound up-regulation of adipsin in both WAT and BAT (FIG. 10) most certainly is of great importance. Adipsin is a secreted protein necessary for the formation of acylation stimulating protein (ASP), which has potent anabolic effects on human adipose tissue for both glucose and free fatty acid (FFA) storage (Cianflone et al., 1995). The extensive alternations seen in the FKHL14/FOXC2 transgenic mice presented here predicts a very central and important role for this winged helix gene hitherto unknown to participate in molecular events in adipose tissue. It has been demonstrated by gene targeting experiments that the mouse homologue, Mfh1, plays a crucial role during embryonic development (Iida et al., 1997; Winnier et al., 1997), but so far nothing has been published about its function in adult mice. In a recent publication an Mfh1/Pax1 double mutant was shown to be totally absent of BAT at day 15.5 dpc (Furumoto et al., 1999). The FKHL14/FOXC2 transgenic mice had a clear reduction in white adipose tissue mass. The reduced size of the white fat depots might be due solely to the reduction in size of the adipocytes (FIG. 8), but one cannot rule out the possibility that there is also a reduction in adipocyte number. There are a number of possible reasons why the FKHL14/FOXC2 transgenic mice have decreased size of white adipocytes. One might presume an increased lipolytic activity of their adipocytes in general; coupled with the greater mass of brown fat this may lead to increased energy expenditure through heat production by BAT giving rise to the lean phenotype. The upregulation of .beta.3 -AR seen in transgenic WAT (FIG. 10) will result in an elevated activation of HSL hence an increase in lipolysis (FIG. 1) ultimately leading to reduced lipid storing. Furthermore, the transgenic mice were insulin sensitive (FIG. 14); this could be explained by both the upregulation of genes involved in insulin action (InsR, IRS-1, IRS-2, and GLUT4; FIG. 10) and the lean body composition (FIG. 12). Insulin has a critical role in lipid metabolism, promoting the storage of triglycerides in adipocytes through numerous actions on this cell. Among these are stimulation of glucose uptake and inhibition of lipolysis, which occur very rapidly through insulin-responsive glucose transporter protein (GLUT 4) translocation or covalent modification of HSL, respectively. Insulin also stimulates fatty acid and triglyceride synthesis, through the induction of key lipogenic enzymes and induction of lipoprotein lipase. The data presented here are compatible with an increased energy turnover in the adipocytes derived from FKHL14/FOXC2 transgenic mice. The white fat depots of FKHL14/FOXC2 transgenic mice had an ectopic expression of the brown fat specific marker UCP1 (FIG. 10). The origin of multilocular adipocytes in transgenic WAT (FIG. 8d) remains an enigma. It has been suggested that there is a pool of intraconveritble cells or small brown preadipocytes present in WAT. Studies on both rat and mice have demonstrated atypical occurrence of UCP1 in certain WAT depots previously thought to contain only white adipocytes (Cousin et al., 1992; Loncar, 1991). If submitted to cold or to treatment with a .beta.3 -AR selective agonist, UCP1 expression was increased in WAT as in typical BAT and on histological sections one could identify small multilocular cells interspersed between the white adipocytes, which were shown to contain UCP1 by immunhistochemistry (Cousin et al., 1992; Ghorbani et al., 1997). Furthermore, both UCP1 and .beta.3 -AR mRNAs have been detected in white fat depots of human beings (Krief et al., 1993) and recently, it has been shown that cultures of human adipocytes derived from white fat depots express UCP1 after treatment with .beta.3 -AR agonists (Champigny and Ricquier, 1996). Moreover, transgenic mice overexpressing .beta.1 -AR in WAT and BAT have abundant appearance of brown fat cells in subcutaneous WAT (Soloveva et al., 1997). We would like to speculate that these suggested intraconveritble cells or small brown preadipocytes have undergone proliferation in our transgenic mice, readily detectable on histological sections as small multilocular cells (FIG. 8d), due to the increased expression of .beta.3 -AR. The FKHL14/FOXC2 transgene possibly activates other proteins further down the signal transduction pathway finally leading to the induction of UCP1 expression. In addition, the levels of C/EBP.alpha. and PPAR.gamma. mRNAs in transgenic WAT reaches the ones in wild-type BAT (FIG. 10) and both of these transcription factors are known to induce UCP1 expression (Digby et al., 1998; Yubero et al., 1994). C/EBP.alpha. activates several adipocyte-specific genes and also genes involved in insulin action (FIG. 15), hence C/EBP.alpha. (-/-) cells show a complete absence of insulin-stimulated glucose transport, secondary to reduced gene expression and tyrosine phosphorylation for the insulin receptor and IRS-1 (Wu et al., 1999b). The WAT of FKHL14/FOXC2 transgenic mice have marked elevation of the mRNA levels for both C/EBP.alpha. and PPAR.gamma., these transcription factors may in turn be responsible for upregulation of mRNA levels for aP2, LPL, UCP1, GLUT4, insulin receptor, and IRS-1 (FIG. 15) It is interesting to note that the white adipocytes of FKHL14/FOXC2 transgenic mice have not just converted into brown adipocytes, in the meaning of mRNA expression, as they have for example higher levels of certain mRNAs (i.e. .beta.2 -AR, insulin receptor, IRS-1, and IRS-2) than seen in any type of wild-type adipose tissue. In the mice studied here, FKHL14/FOXC2 transgene expression was under the control of the aP2 promoter, which only functions in adipocytes and not in stem cells and probably neither in intraconveritble cells discussed above (Ailhaud et al., 1992). Considering the fact that aP2 is a late marker (FIG. 2) it is quite surprising that we obtain such a dramatic change in the characteristics of white adipocytes. Currently, it is not known if adipocyte dedifferentiation occurs in vivo, whereas it has been demonstrated in vitro that this process occurs and is induced by TNF.alpha. in human adipocytes (Petruschke and Hauner, 1993). Another interpretation for the occurrence of small multilocular cells in WAT of our transgenic mice could then be a dedifferentiation of originally white adipocytes followed by a conversion into the type of adipocytes observed in the FKHL14/FOXC2 transgenic mice. The interscapular brown fat of FKHL14/FOXC2 transgenic mice weighed .about.7.5 times as much as wild-type brown fat (FIG. 9a). This extreme hypertrophy might be explained by the increased expression of .beta.3 - and .beta.2 -AR mRNA seen in BAT of FKHL14/FOXC2 transgenic mice (FIG. 10). Chronic treatment with .beta.3 -AR agonists increases body temperature and energy expenditure and it causes hypertrophy of the interscapular BAT, with several fold increases in the content of UCP1 and cytochrome oxidase (Himms-Hagen et al., 1994). The morphology of transgenic interscapular BAT is somewhat changed having larger fat droplets than wild-type BAT (FIGS. 8a & b). This is not a feature of chronic .beta.3 -AR agonist treatment, but there is a possibility that the upregulation of markers involved in insulin action (FIG. 10) and elevated levels of adipsin promotes the increased storage of triglycerides in brown adipocytes of transgenic mice. It has also been noticed before that elevated levels of UCP2 mRNA can be coupled to this phenotype (Enerback et al., 1997; Kozak et al., 1991). Dysfunctional BAT seen in the ADD1/nSREBP-1c transgene (Shimomura et al., 1998) and genetically ablated BAT in the UCP1-DTA transgene (UCP1 promoter--diphtheria toxin A chain) (Lowell et al., 1993) leads to insulin resistance. Transgenic mice overexpressing ADD1/nSREBP-1c displays several features quiet opposite the ones of the FKHL14/FOXC2 transgene, including insulin resistance and NIDDM. FKHL14/FOXC2 transgenic mice displays a somewhat opposite change of expression pattern compared with that of ADD1/nSREBP-1c transgenic mice, there the mRNAs encoding PPAR.gamma., C/EBP.alpha., aP2, UCP1, adipsin, InsR, IRS-1, IRS-2, and GLUT4 all are downregulated. In our transgene all of this mRNAs are instead upregulated (FIG. 10). However, intriguingly our transgenic mice actually have raised levels of ADD1/SREBP1 mRNA in WAT (FIG. 10) somewhat mimicking the ADD1/nSREBP-1c transgene in that regard. FKHL14/FOXC2 might be an important participant in the regulation of leptin expression, based on the fact that leptin mRNA levels are down-regulated in FKHL14/FOXC2 transgenic mice (most prominent in BAT; FIG. 10), and the ten-fold decrease of Ob promoter activity seen in cell culture experiments then cotransfected with FKHL14/FOXC2 expression plasmid (FIG. 4). In addition, leptin expression is inhibited by .beta.3 -adrenergic stimuli (Mantzoros et al., 1996), which is presumed to be high in FKHL14/FOXC2 transgenic mice due to the up-regulation of .beta.3 -AR mRNA levels. The amount of food consumed by transgenic mice compared to that of wild-type did not differ (FIG. 9d), and no significant difference in body weight has been observed, predicting that the difference observed in total body lipid content must be compensated with an increased anabolism in FKHL14/FOXC2 transgenic mice. The FKHL14/FOXC2 transgenic mice most probably also are protected against developing diet-induced obesity, taking in consideration the observed insulin sensitivity (FIG. 14), the lower blood glucose levels and more efficient glucose elimination (FIG. 13) observed in our transgenic mice. Insulin sensitivity and/or resistance to diet-induced obesity have been observed for several other transgenic mouse models: targeted disruption of the RII.beta. subunit of protein kinase A results in lean mice resistant to diet-induced obesity (Cummings et al., 1996), mice lacking the protein tyrosine phosphatase-1B gene (PTP-1B) are insulin sensitive and resistant to obesity (Elchebly et al., 1999), aP2-UCP1 transgenic mice are prevented against genetic obesity (Kopecky et al., 1995), and transgenic mice overexpressing the .beta.1 -AR in adipose tissue are resistant to obesity (Soloveva et al., 1997). Moreover, .beta.3 -AR agonists have been found to have anti-diabetic effects in animal models of obesity and NIDDM; chronic dosing can improve glucose tolerance, increase insulin sensitivity and reduce fasting blood glucose levels (Cawthorne et al., 1992). FKHL14/FOXC2 is the only adipocyte specific gene that, directly or indirectly, regulates triglyceride metabolism, adrenergic regulation and insulin action in adipocytes. Actually, the FKHL14, is to our knowledge the only known gene that, in a concerted action, can counteract most, if not all, of the symptoms associated with obesity: hypertriglyceridemia, insulin resistance and most likely the associated clinical syndrome of NIDDM. The apparent FKHL14/FOXC2 transgene dose responsive effect observed in WAT for the induction of UCP1, .beta.3 -AR, and adipsin, may indicate a direct interaction for FKHL14/FOXC2 with the promoters of these genes. A schematic view of the hypothetical action of FKHL14/FOXC2 in adipocytes is shown in FIG. 15. According to the present invention, proper activation of FKHL14/FOXC2 by drugs may decrease fat stores, while preserving skeletal muscle mass, by preventing fat assimilation during digestion and by increasing WAT lipolysis, BAT thermogenesis, and insulin action. Such drugs may thus prove useful in treating obesity and NIDDM as well as associated diseases. It is thus foreseen that an effective amount of a polypeptide encoded by the human FKHL14/FOXC2 gene, could be useful in methods for the treatment of medical conditions related to obesity. In another aspect, this invention relates to a construct, or more specifically a gene construct or recombinant construct, comprising a human FKHL14/FOXC2 nucleotide sequence operably linked to an element selected from the group consisting of promoters, response elements, enhancer elements and mixtures thereof. The term "operably linked" as used herein means functionally fusing an element with a structural gene in the proper frame to express the structural gene under control of the element. Preferably, the said element is a promoter, in particular an adipose-specific promoter such as the adipose-specific promoter of the murine gene encoding adipocyte P2 (FIG. 5), which can be isolated as described by Ross et al. (1990). In a preferred form of the invention, the said FKHL14/FOXC2 nucleotide sequence is identical or substantially similar with SEQ ID NO: 1 of the Sequence Listing. However, the FKHL14/FOXC2 nucleotide sequence is not to be limited strictly to the sequence shown as SEQ ID NO: 1. Rather the invention encompasses constructs comprising nucleotide sequences carrying modifications like substitutions, small deletions, insertions or inversions, which nevertheless encode polypeptides having substantially the biochemical activity of the FKHL14/FOXC2 polypeptide. Consequently, included in the invention are constructs wherein the said human FKHL14/FOXC2 nucleotide sequence is selected from: (a) the nucleotide sequence shown as SEQ ID NO: 1; (b) nucleotide sequences capable of hybridizing, under stringent hybridization conditions, to a nucleotide sequence complementary to the polypeptide coding region of a nucleotide sequence as defined in (a) and which codes for a biologically active FKHL14/FOXC2 polypeptide, or a functionally equivalent modified form thereof; (c) nucleic acid sequence which are degenerate as a result of the genetic code to a nucleotide sequence as defined in (a) or (b) and which codes for a biologically active FKHL14/FOXC2 polypeptide, or a functionally equivalent modified form thereof; and (d) nucleotide sequences which are at least 90% homologous, preferably at least 95% homologous, with the nucleotide sequence shown as SEQ ID NO: 1 in the Sequence Listing. The term "stringent hybridization conditions" is known in the art from standard protocols (e.g. Ausubel et al) and could be understood as e.g. hybridization to filter-bound DNA in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at +65oC., and washing in 0.1xSSC/0.1% SDS at +68oC. In another aspect, the invention provides a transgenic non-human mammalian animal whose genome comprises a gene construct as defined above, said animal being capable of expressing the human FKHL14/FOXC2 gene in its adipose tissue. By "transgenic animal" is meant a non-human mammalian animal that includes a nucleic acid sequence which is inserted into a cell and becomes a part of the genome of the animal that develops from that cell. Such a transgene may be partly or entirely heterologous to the transgenic animal. Although transgenic mice represent a preferred embodiment of the invention, other transgenic mammals, including transgenic rodents (for example, hamsters, guinea pigs, rabbits, and rats), and transgenic pigs, cattle, sheep, and goats may be constructed by standard techniques and are included in the invention. One means available for producing a transgenic animal, with a mouse as an example, is as follows: Female mice are mated, and the resulting fertilized eggs are dissected out of their oviducts. The eggs are stored in an appropriate medium. DNA or cDNA encoding the FKHL14/FOXC2 gene is purified from a vector by methods well known in the art. Tissue specific regulatory elements, such as the adipocyte-specific aP2 promoter discussed above, may be fused with the coding region to permit tissue-specific expression of the trans-gene. The DNA, in an appropriately buffered solution, is put into a microinjection needle and the egg to be injected is put in a depression slide. The needle is inserted into the pronucleus of the egg, and the DNA solution is injected. The injected egg is then transferred into the oviduct of a pseudopregnant mouse, where it proceeds to the uterus, implants, and develops to term. A transgenic mouse according to the invention could preferably be derived from a genetically obese mouse. Genetically obese mice, such as ob/ob or db/db mice, are well known in the art. In a further aspect, the invention provides an isolated cell line derived from the transgenic non-human mammalian animal. In yet another aspect, the invention provides a method for producing a transgenic non-human mammalian animal overexpressing the human FKHL14/FOXC2 gene, said method comprising chromosomally incorporating a gene construct comprising the human FKHL14/FOXC2 gene, together with suitable regulatory sequences, into the genome of said non-human mammalian animal. The invention also provides a method for studying the biological activity of a polypeptide encoded by the human FKHL14/FOXC2 gene, said method comprising the steps (i) producing a transgenic non-human mammalian animal overexpressing the human FKHL14/FOXC2 gene; and (ii) comparing the phenotype of the said transgenic non-human mammalian animal with a wild-type animal of the same species. In further important aspects, the invention provides biological screening assays for the identification of compounds that could be useful for the treatment of medical conditions related to obesity, or alternatively, to malnutrition. A "medical condition related to obesity" includes e.g. obesity, NIDDM, hypertension and hyperlipidemia. The said "medical condition related to malnutrition" includes e.g. anorexia, ineffective metabolism, and cancer. Consequently, the invention provides a method for identifying a compound useful for the treatment of a medical condition related to obesity, said method comprising the steps (i) contacting a test compound with the human FKHL14/FOXC2 gene; and (ii) determining whether said test compound activates the expression of the human FKHL14/FOXC2 gene, such activation being indicative for a compound useful for the treatment of a medical condition related to obesity. In another aspect, the invention provides a method of screening for a compound useful for the treatment of a medical condition related to obesity, said method comprising exposing a non-human mammalian animal to a test compound, and determining the activity of said human FKHL14/FOXC2 gene in said non-human mammalian animal, wherein an increase in said gene activity as compared to an untreated non-human mammalian animal being indicative of a compound useful for the treatment of a medical condition related to obesity. The said non-human mammalian animal is preferably a mouse, for example an obese mouse. Mice can be rendered obese by administration of a high-fat diet. Alternatively, the mouse can be a genetically obese mouse, such as an ob/ob or db/db mouse. In the methods described above, the activity of the human FKHL14/FOXC2 gene in said non-human mammalian animal, can advantageously be compared to the activity of the said human FKHL14/FOXC2 gene in a transgenic non-human mammalian animal expressing or overexpressing the said human FKHL14/FOXC2 gene. In an alternative method for identifying a compound useful for the treatment of a medical condition related to obesity, the method comprises the steps (i) contacting a test compound with a polypeptide encoded by the human FKHL14/FOXC2 gene; and (ii) determining whether said test compound stimulates the biological activities of the said polypeptide, such stimulation being indicative for a compound useful for the treatment of a medical condition related to obesity. The term "biological activities", as used in this context, means e.g. enhancing the DNA-protein interaction between the FKHL14/FOXC2 polypeptide and target sequences in promoters of target genes. The invention further provides a method for identifying a compound useful for the treatment of a medical condition related to malnutrition, said method comprising the steps (i) contacting a test compound with the human FKHL14/FOXC2 gene; and (ii) determining whether said test compound decreases or inhibits expression of the FKHL14/FOXC2 gene, such decrease or inhibition being indicative for a compound useful for the treatment of a medical condition related to malnutrition. Also included in the invention is a method of screening for a compound useful for the treatment of a medical condition related to malnutrition, said method comprising exposing a non-human mammalian animal, preferably a mouse, such as an obese mouse, to a test compound, and determining the activity of said human FKHL14/FOXC2 gene in said non-human mammalian animal, wherein a decrease in said gene activity as compared to an untreated non-human mammalian animal being indicative of a compound useful for the treatment of a medical condition related to malnutrition. In an alternative method for identifying a compound useful for the treatment of a medical condition related to malnutrition, the method comprises the steps (i) contacting a test compound with a polypeptide encoded by the human FKHL14/FOXC2 gene; and (ii) determining whether said test compound decreases or inhibits the biological activities of the said polypeptide, such decrease or inhibition being indicative for a compound useful for the treatment of a medical condition related to malnutrition. For therapeutic uses, the compositions or agents identified using the methods disclosed herein may be administered systemically, for example, formulated in a pharmaceutically acceptable buffer such as physiological saline. Preferable routes of administration include, for example, oral, subcutaneous, intravenous, intraperitoneally, intramuscular, or intradermal injections, which provide continuous, sustained levels of the drug in the patient. Treatment of human patients or other animals will be carried out using a therapeutically effective amount of an identified compound in a physiologically acceptable carrier. Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin. The amount of the active compound to be administered varies depending upon the manner of administration, the age and body weight of the patient, and with the type of disease and extensiveness of the disease. Generally, amounts will be in the range of those used for other agents used in the treatment of obesity and diabetes. In a further important aspect of the invention, the human FKHL14/FOXC2 gene could be used in gene therapy of medical conditions related to obesity. Included in the invention is thus a method of treating obesity in a human, comprising (i) administering to the said human a vector comprising a human FKHL14/FOXC2 DNA sequence operably linked to a promoter; and (ii) allowing the said human to express a therapeutically effective amount of a polypeptide encoded by said human FKHL14/FOXC2 gene. A gene delivery system including said vector, comprising a human FKHL14/FOXC2 DNA sequence operably linked to a promoter, is in itself another aspect of the invention. The FKHL14/FOXC2 gene should be operably linked to at least one element which allows for expression of the gene when introduced into the host cell environment. These sequences include promoters, response elements, and enhancer elements. Preferred is the adipose-specific promoter/enhancer of the murine gene encoding adipocyte P2 The heterologous gene may be delivered to the organism using a vector or other delivery vehicle. DNA delivery vehicles can include viral vectors such as adenoviruses, adeno-associated viruses, and retroviral vectors. See, for example: Chu et al. (1994) Gene Ther 1: 292-299; Couture et al. (1994) Hum Gene Ther 5:667-677; and Eiverhand et al. (1995) Gene Ther 2: 336-343. Non-viral vectors which are also suitable include DNA-lipid complexes, for example liposome-mediated or ligand/poly-L-Lysine conjugates, such as asialoglyco-protein-mediated delivery systems. See, for example: Feigner et al. (1994) J. Biol. Chem, 269: 2550-2561; Derossi et al. (1995) Restor. Neurol. Neuros. 8: 7-10; and Abcallah et al. (1995) Biol. Cell 85: 1-7. If a vector is chosen as the delivery vehicle for the gene, it may be any vector which allows expression of the gene in the host cells. It is preferable if the vector also is one that is capable of integrating into the host genome, so that the gene can be expressed permanently. Ad (adenovirus) vectors have been exploited for the delivery of foreign genes to cells for a number of reasons, including the fact that Ad vectors have been shown to be highly effective for the transfer of genes into a wide variety of tissues in vivo and the fact that Ad infects both dividing and non-dividing cells. The vector is administered to the host, generally by intravenous injection. Suitable titers will depend on a number of factors, such as the particular vector chosen, the host, strength of promoter used and the severity of the disease being treated. Alternatively, it is contemplated that in some human disease states, preventing the expression of, or decreasing the activity of, the human FKHL14/FOXC2 gene will be useful in treating disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of the human FKHL14/FOXC2 gene. Antisense nucleic acids (preferably 10 to 20 base-pair oligonucleotides) capable of specifically binding to FKHL14/FOXC2 expression control sequences or FKHL14/FOXC2 RNA are introduced into cells (e.g. by a viral vector or colloidal dispersion system such as a liposome). The antisense nucleic acid binds to the FKHL14/FOXC2 target nucleotide sequence in the cell and prevents transcription and/or translation of the target sequence. Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5'-end. Suppression of FKHL14/FOXC2 expression at either the transcriptional or translational level is useful to generate cellular or animal models for diseases/conditions characterized by aberrant FKHL14/FOXC2 expression. Throughout this description the terms "standard protocols" and "standard procedures", when used in the context of molecular biology techniques, are to be understood as protocols and procedures found in an ordinary laboratory manual such as: Current Protocols in Molecular Biology, editors F. Ausubel et al., John Wiley and Sons, Inc. 1994, or Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989. EXPERIMENTAL METHODS Cloning and DNA Construct A human adipose tissue .lambda.gt11 cDNA library (Clontech) was screened with a probe mixture corresponding to the conserved fork-head domain derived from: FOXC1, FOXD1, FOXL1, and FOXA1. Hybridization was carried out at low stringency, i.e. 6xSSC at +60oC., post-hybridization washes at 0.5xSSC at +60oC. One of the positive recombinants harboring a 2.1 kb insert was subcloned and sequenced. A 5.4-kb EcoRV-SmaI fragment was excised from pBluescript II SK(+) vector containing the 5.4-kb promoter/enhancer of the mouse aP2 gene and ligated into the EcoRV-SpeI blunt site of pBluescript II SK(+) vector containing the 2.1 kb FOXC2 cDNA. A 7.6 kb XhoI blunt fragment containing the aP2 promoter/enhancer followed by the FOXC2 cDNA was excised from the above plasmid and ligated into the EcoRV site of the pCB6+ vector, which contains a polyadenylation signal from the human growth hormone gene. After these procedures the resulting 8.2-kb fragment, harboring the aP2-FOXC2 construct with polyadenylation signal, was flanked by the unique sites NotI and AgeI. The plasmid was sequenced over ligation sites. Transgenic Mice Construct DNA (aP2-FOXC2), purified using Qiagen kit, according to manufacturer's instructions, was injected into the male pronucleus of (C57BL6xCBA) F1 zygotes, cultured over night and transferred to pseudopregnant females. Tg founder lines were back-crossed to C57BL6/J for four generations. Mice were feed a standard chow with 4% fat content. In experiments with high fat diet mice were fed either a chow with 58% fat or a control diet with 11.4% fat (on a caloric basis; Research Diets) for 7 weeks. High fat chow has a total energy content of 23.4 KJ/g, control diet 12.6 KJ/g. Histology Tissues were fixed over night in 4% paraformaldehyde in PBS at +4oC., dehydrated, embedded in paraffin, sectioned (6-8 .mu.m) and stained with haematoxylin and eosin. Serum and Lipid Analysis Plasma insulin was determined radioimmunochemically with the use of a guinea pig anti-rat insulin antibody, 125 I-labeled porcine insulin as tracer and rat insulin as standard (Linco). Free and bound radioactivity was separated by use of an anti-IgG (goat anti-guinea pig) antibody (Linco). The sensitivity of the assay is 17 pmol/l and the coefficiency of variation is less than 3% at both low and high levels. Plasma glucose was determined with the glucose oxidase method and FFA was measured photometrically. Plasma glucagon was determined radioimmunochemically with the use of a guinea pig antiglucagon antibody specific for pancreatic glucagon, 125 I-labelled-glucagon as tracer, and glucagon standard (Linco). Free and bound radioactivity was separated by use of an anti-IgG (goat anti-guinea pig) antibody (Linco). The sensitivity of the assay is 7.5 .mu.g/ml and the coefficient of variation is less than 9%. Blood levels of serum cholesterol and triglycerides were determined by fully enzymatic techniques 39,40. Total body lipid was assessed using alcoholic hydroxide digestion with saponification of all lipids, neutralization, followed by enzymatic determination of glycerol. Intravenous Glucose Tolerance Test The mice were anesthetized with an intraperitoneal injection of midazolam 0.4 mg/mouse (Hoffman-La-Roche) and a combination of fluanison (0.9 mg/mouse) and fentanyl 0.02 mg/mouse (Janssen). Thereafter, a blood sample was taken from the retrobulbar, intraorbital, capillary plexus in heparinized tubes, and D-glucose 1 g/kg L(British Drug Houses) was injected rapidly intravenously. New blood samples were taken after 1, 5, 20, and 50 minutes. Following immediate centrifugation at +4oC., plasma was separated and stored at -20oC. or until analysis. Northern Blot cDNA probes for mouse FoxC2, aP2, ADD-1/SREBP1, coxII, adipsin, .beta.1-3 -AR, GLUT4, IR, IRS1, and IRS2 were prepared by RT-PCR by use of first-strand cDNA from mouse epididymal fat poly(A)+ RNA. The PCR primers used to generate these probes were as follows: FoxC2: 5' primer, GCTTCGCCTCCTCCATGGGAA (SEQ ID NO:3) and 3' primer, GGTTACAAATCCGCACTCGTT (SEQ ID NO:4) (GenBank #Y08222). aP2: 5' primer, CTC CTG TGCTGCAGCCTTTCTC (SEQ ID NO:5) and 3' primer, CGTAACTCACCACCACCAGCTTGTC (SEQ ID NO:6) (GenBank #M13261). ADD1/SREBP-1: 5' primer, GCCAACTCTCCTGAGAGCTT (SEQ ID NO:7) and 3' primer, CTCCTGCTTGAGCTTCTGGTT (SEQ ID NO:8) (GenBank #AB017337). CoxII: 5' primer, CCATTCCAACTTGGTCTACAA (SEQ ID NO:9) and 3' primer, GGAACCATTTCTAGGACAATG (SEQ ID NO:10) (GenBank #J01420). Adipsin: 5' primer, CGAGGCCGGATTCTGGGTGGCCAG (SEQ ID NO:11) and 3' primer, TCGATCCACATCCGGTAGGATG (SEQ ID NO:12) (GenBank #X04673). .beta.1 -AR: 5' primer, CGGCTGCAGACGCTCACCAA (SEQ ID NO:13) and 3' primer, CGCCACCAGTGCATGAGGAT ((SEQ ID NO:14) GenBank #L10084). .beta.2 -AR: 5' primer, GCTGCAGAAGATAGACAAAT (SEQ ID NO:15) and 3' primer, GGGATCCTCACACAGCAGTT (SEQ ID NO:16) (GenBank #X15643). .beta.3 -AR: 5' primer, CTGCTAGCATCGAGACCTT (SEQ ID NO:17) and 3' primer, CGAGCATAGACGAAGAGCAT (SEQ ID NO:18) (GenBank #X60438). GLUT4: 5' primer,CTCAGCAGCGAGTGACTGGGAC (SEQ ID NO:19) and 3' primer, CCCTGAGTAGGCGCCAATGAGG (SEQ ID NO:20) (GenBank #D28561). IR: 5' primer, GTAGCCTGATCATCAACATCCG (SEQ ID NO:21) and 3' primer, CCTGCCCATCAAACTCTGTCAC (SEQ ID NO:22) (GenBank #J05149). IRS 1: 5' primer, ATGGCGAGCCCTCCGGATACCG (SEQ ID NO:23) and 3' primer, CCTCTCCAACGCCAGAAGCTGCC (SEQ ID NO:24) (GenBank #X69722). IRS2: 5' primer, GGATAATGGTGACTATACCGAGA (SEQ ID NO:25) and 3' primer, CTCACATCGATGGCGATATAGTT (SEQ ID NO:26) (GenBank #AF090738). cDNA probes were radiolabeled with [.alpha.-32 P]dCTP (3000 Ci/mmole) by the random labeling method. Total RNA from mice in each group was pooled, and aliquots of 12 .mu.g were separated on an agarose gel. The filters were hybridized with 32 P-labeled probe (106 cpm/ml) for 1 h at 62oC. with QuikHyb solution (Stratagene) and washed with 0.1% SDS/0.1xSSC at +62oC. for 3x20 min. Transfections and Reporter Gene Analysis Non-confluent cultures of 3T3-L1 adipocytes were transfected with a CAT reporter (pCAT) driven by the human RI.alpha. proximal promoters upstream of the alternatively spliced 1a and 1b leader exons (nucleotides 1509 to 2470 GenBank #Y07641). To control transfection efficiency a pGL3control (Promega) luciferase-encoding vector was used. In cotransfections a FOXC2 expression vector or vector void of insert was used. Transfections were carried out using lipofectamine (Gibco), followed by CAT and luciferase assays. Claim 1 of 13 Claims What is claimed is: 1. A construct comprising an adiposc-specific promoter operably linked to a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2.
____________________________________________
|
|
|