Patent 6,821,957

The present invention shows that DNA vaccine vectors can be improved by removal of CpG-N motifs and optional addition of CpG-S motifs. In addition, for high and long-lasting levels of expression, the optimized vector should include a promoter/enhancer that is not down-regulated by the cytokines induced by the immunostimulatory CpG motifs. Vectors and methods of use for immununostimulation are provided herein. The invention also provides improved gene therapy vectors by determining the CpG-N and CpG-S motifs present in the construct, removing stimulatory CpG (CpG-S) motifs and/or inserting neutralizing CpG (CpG-N) motifs, thereby producing a nucleic acid construct providing enhanced expression of the therapeutic polypeptide. Methods of use for such vectors are also included herein.

Description of the Invention

TECHNICAL FIELD

This invention relates generally to immune responses and more particularly to vectors containing immunostimulatory CpG motifs and/or a reduced number of neutralizing motifs and methods of use for immunization purposes as well as vectors containing neutralizing motifs and/or a reduced number of immunostimulatory CpG motifs and methods of use for gene therapy protocols.

BACKGROUND OF THE INVENTION

Bacterial DNA, but not vertebrate DNA, has direct immunostimulatory effects on peripheral blood mononuclear cells (PBMC) in vitro (Messina et al., J. Immunol. 147: 1759-1764, 1991; Tokanuga et al., JNCI. 72: 955, 1994). These effects include proliferation of almost all (>95%) B cells and increased immunoglobulin (Ig) secretion (Krieg et al., Nature. 374: 546-549, 1995). In addition to its direct effects on B cells, CpG DNA also directly activates monocytes, macrophages, and dendritic cells to secrete predominantly Th 1 cytokines, including high levels of IL-12 (Klinman, D., et al. Proc. Natl. Acad. Sci. USA. 93: 2879-2883 (1996); Halpern et al. 1996; Cowdery et al., J. Immunol. 156: 4570-4575 (1996). These cytokines stimulate natural killer (NK) cells to secrete .gamma.-interferon (IFN-.gamma.) and to have increased lytic activity (Klinman et al., 1996, supra; Cowdery et al., 1996, supra; Yamamoto et al., J. Immunol. 148: 4072-4076 (1992); Ballas et al., J. Immunol. 157: 1840-1845 (1996)). These stimulatory effects have been found to be due to the presence of unmethylated CpG dinucleotides in a particular sequence context (CpG-S motifs) (Krineg et al., 1995, supra). Activation may also be triggered by addition of synthetic oligodeoxynucleotides (ODN) that contain CpG-S motifs (Tokunaga et al., Jpn. J. Cancer Res. 79: 682-686 1988; Yi et al., J. Immunol. 156: 558-564, 1996; Davis et al., J. Immunol. 160: 870-876, 1998).

Unmethylated CpG dinucleotides are present at the expected frequency in bacterial DNA but are under-represented and methylated in vertebrate DNA (Bird, Trends in Genetics. 3: 342-347, 1987). Thus, vertebrate DNA essentially does not contain CpG stimulatory (CpG-S) motifs and it appears likely that the rapid immune activation in response to CpG-S DNA may have evolved as one component of the innate immune defense mechanisms that recognize structural patterns specific to microbial molecules.

Viruses have evolved a broad range of sophisticated strategies for avoiding host immune defenses. For example, nearly all DNA viruses and retroviruses appear to have escaped the defense mechanism of the mammalian immune system to respond to immunostimulatory CpG motifs. In most cases this has been accomplished through reducing their genomic content of CpG dinucleotides by 50-94% from that expected based on random base usage (Karlin et al., J. Virol. 68: 2889-2897, 1994). CpG suppression is absent from bacteriophage, indicating that it is not an inevitable result of having a small genome. Statistical analysis indicates that the CpG suppression in lentiviruses is an evolutionary adaptation to replication in a eukaryotic host (Shaper et al., Nucl. Acids Res. 18: 5793-5797, 1990).

Nearly all DNA viruses and retroviruses appear to have evolved to avoid this defense mechanism through reducing their genomic content of CpG dinucleotides by 50-94% from that expected based on random base usage. CpG suppression is absent from bacteriophage, indicating that it is not an inevitable result of having a small genome. Statistical analysis indicates that the CpG suppression in lentiviruses is an evolutionary adaptation to replication in a eukaryotic host. Adenoviruses, however, are an exception to this rule as they have the expected level of genomic CpG dinucleotides. Different groups of adenovirae can have quite different clinical characteristics. Serotype 2 and 5 adenoviruses (Subgenus C) are endemic causes of upper respiratory infections and are notable for their ability to establish persistent infections in lymphocytes. These adenoviral serotypes are frequently modified by deletion of early genes for use in gene therapy applications, where a major clinical problem has been the frequent inflammatory immune responses to the viral particles. Serotype 12 adenovirus (subgenus A) does not establish latency, but can be oncogenic.

Despite high levels of unmethylated CpG dinucleotides, serotype 2 adenoviral DNA surprisingly is nonstimulatory and can actually inhibit activation by bacterial DNA. The arrangement and flanking bases of the CpG dinucleotides are responsible for this difference. Even though type 2 adenoviral DNA contains six times the expected frequency of CpG dinucleotides, it has CpG-S motifs at only one quarter of the frequency predicted by chance. Instead, most CpG motifs are found in clusters of direct repeats or with a C on the 5' side or a G on the 3' side. It appears that such CpG motifs are immune-neutralizing (CpG-N) in that they block the Th1-type immune activation by CpG-S motifs in vitro. Likewise, when CpG-N ODN and CpG-S are administered with antigen, the antigen-specific immune response is blunted compared to that with CpG-S alone. When CpG-N ODN alone is administered in vivo with an antigen, Th2-like antigen-specific immune responses are induced.

B cell activation by CpG-S DNA is T cell independent and antigen non-specific. However, B cell activation by low concentrations of CpG DNA has strong synergy with signals delivered through the B cell antigen receptor for both B cell proliferation and Ig secretion (Krieg et al., 1995, supra). This strong synergy between the B cell signaling pathways triggered through the B cell antigen receptor and by CpG-S DNA promotes antigen specific immune responses. The strong direct effects (T cell independent) of CpG-S DNA on B cells, as well as the induction of cytokines which could have indirect effects on B-cells via T-help pathways, suggests utility of CpG-S DNA as a vaccine adjuvant. This could be applied either to classical antigen-based vaccines or to DNA vaccines. CpG-S ODN have potent Th-1 like adjuvant effects with protein antigens (Chu et al., J. Exp. Med. 186: 1623-1631 1997; Lipford et al., Eur. J. Immunol. 27: 2340-2344, 1997; Roman et al., Nature Med. 3: 849-854, 1997; Weiner et al., Proc. Natl. Acad. Sci. USA. 94: 10833, 1997; Davis et al., 1998, supra, Moldoveanu et al., A Novel Adjuvant for Systemic and Mucosal Immunization with Influenza Virus. Vaccine (in press) 1998).

SUMMARY OF THE INVENTION

The present invention is based on the discovery that removal of neutralizing motifs (e.g., CpG-N or poly G) from a vector used for immunization purposes, results in an antigen-specific immunostimulatory effect greater than with the starting vector. Further, when neutralizing motifs (e.g., CpG-N or poly P) are removed from the vector and stimulatory CpG-S motifs are inserted into the vector, the vector has even more enhanced immunostimulatory efficacy.

In a first embodiment, the invention provides a method for enhancing the immunostimulatory effect of an antigen encoded by nucleic acid contained in a nucleic acid construct including determining the CpG-N and CpG-S motifs present in the construct and removing neutralizing CpG (CpG-N) motifs and optionally inserting stimulatory CpG (CpG-S) motifs in the construct, thereby producing a nucleic acid construct having enhanced immunostimulatory efficacy. Preferably, the CpG-S motifs in the construct include a motif having the formula 5'X₁ CGX₂ 3' wherein at least one nucleotide separates consecutive CpGs, X₁ is adenine, guanine, or thymine and X₂ is cytosine, thymine, or adenine.

In another embodiment, the invention provides a method for stimulating a protective or therapeutic immune response in a subject. The method includes administering to the subject an effective amount of a nucleic acid construct produced by determining the CpG-N and CpG-S motifs present in the construct and removing neutralizing CpG (CpG-N) motifs and optionally inserting stimulatory CpG (CpG-S) motifs in the construct, thereby producing a nucleic acid construct having enhanced immunostimulatory efficacy and stimulating a protective or therapeutic immune response in the subject. Preferably, the nucleic acid construct contains a promoter that functions in eukaryotic cells and a nucleic acid sequence that encodes an antigen to which the immune response is direct toward. Alternatively, an antigen can be admininstered simulataneously (e.g., admixture) with the nucleic acid construct.

In another embodiment, the invention provides a method for enhancing the expression of a therapeutic polypeptide in vivo wherein the polypeptide is encoded by a nucleic acid contained in a nucleic acid construct. The method includes determining the CpG-N and CpG-S motifs present in the construct, optionally removing stimulatory CpG (CpG-S) motifs and/or inserting neutralizing CpG (CpG-N) motifs, thereby producing a nucleic acid construct providing enhanced expression of the therapeutic polypeptide.

In yet another embodiment, the invention provides a method for enhancing the expression of a therapeutic polypeptide in vivo. The method includes administering to a subject a nucleic acid construct, wherein the construct is produced by determining the CpG-N and CpG-S motifs present in the construct and optionally removing stimulatory CpG (CpG-S) motifs and/or inserting neutralizing CpG (CpG-N) motifs, thereby enhancing expression of the therapeutic polypeptide in the subject.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides vectors for immunization or therapeutic purposes based on the presence or absence of CpG dinucleotide immunomodulating motifs. For immunization purposes, immunostimulatory motifs (CpG-S) are desirable while immunoinhibitory CpG motifs (CpG-N) are undesirable, whereas for gene therapy purposes, CpG-N are desirable and CpG-S are undesirable. Plasmid DNA expression cassettes were designed using CpG-S and CpG-N motifs. In the case of DNA vaccines, removal of CpG-N motifs and addition of CpG-S motifs should allow induction of a more potent and appropriately directed immune response. The opposite approach with gene therapy vectors, namely the removal of CpG-S motifs and addition of CpG-N motifs, allows longer lasting therapeutic effects by abrogating immune responses against the expressed protein.

DNA Vaccines

DNA vaccines have been found to induce potent humoral and cell-mediated immune responses. These are frequently Th1-like, especially when the DNA is administered by intramuscular injection (Davis, H. L. (1998) Gene-based Vaccines. In: Advanced Gene Delivery: From Concepts to Pharmaceutical Products (Ed. A. Rolland), Harwood Academic Publishers (in press); Donnelly et al., Life Sciences 60:163, 1997; Donnelly et. al., Ann Rev. Immunol. 15:617, 1997; Sato et al., Science 273:352, 1996). Most DNA vaccines comprise antigen-expressing plasmid DNA vectors. Since such plasmids are produced in bacteria and then purified, they usually contain several unmethylated immunostimulatory CpG-S motifs. There is now convincing evidence that the presence of such motifs is essential for the induction of immune responses with DNA vaccines (see Krieg et al., Trends Microbiology. 6: 23-27, 1998). For example, it has been shown that removal or methylation of potent CpG-S sequences from plasmid DNA vectors reduced or abolished the in vitro production of Th1 cytokines (e.g., IL-12, IFN-.alpha., IFN-.gamma.) from monocytes and the in vivo antibody and CTL response against an encoded antigen (.beta.-galactosidase) (Sato et al., 1996, supra; Klinman et al., J. Immunol. 158: 3635-3639 (1997). Potent responses could be restored by cloning CpG-S motifs back into the vectors (Sato et al., 1996, supra) or by coadministering CpG-S ODN (Klinman et al., 1997, supra). The humoral response in monkeys to a DNA vaccine can also be augmented by the addition of E. coli DNA (Gramzinski et al., Molec. Med. 4: 109-119, 1998). It has also been shown that the strong Th1 cytokine pattern induced by DNA vaccines can be obtained with a protein vaccine by the coadministration of empty plasmid vectors (Leclerc et al., Cell Immunology. 170: 97-106, 1997).

The present invention shows that DNA vaccine vectors can be improved by removal of CpG-N motifs and further improved by the addition of CpG-S motifs. In addition, for high and long-lasting levels of expression, the optimized vector should preferably include a promoter/enhancer, which is not down-regulated by the cytokines induced by the immunostimulatory CpG motifs.

It has been shown that the presence of unmethylated CpG motifs in the DNA vaccines is essential for the induction of immune responses against the antigen, which is expressed only in very small quantities (Sato et al., 1996, Klinman et al., 1997, supra). As such, the DNA vaccine provides its own adjuvant in the form of CpG DNA. Since single-stranded but not double-stranded DNA can induce immunostimulation in vitro, the CpG adjuvant effect of DNA vaccines in vivo is likely due to oligonucleotides resulting from plasmid degradation by nucleases. Only a small portion of the plasmid DNA injected into a muscle actually enters a cell and is expressed; the majority of the plasmid is degraded in the extracellular space.

The present invention provides DNA vaccins vectors further improved by removal of undesirable immunoinhibitory CpG motifs and addition of appropriate CpG immunostimulatory sequences in the appropriate number and spacing. The correct choice of immunostimulatory CpG motifs could allow one to preferentially augment humoral or CTL responses, or to preferentially induce certain cytokines.

The optimized plasmid cassettes of the invention arc ready to receive genes encoding any particular antigen or group of antigens or antigenic epitopes. One of skill in the art can create cassettes to preferentially induce certain types of immunity, and the choice of which cassette to use would depend on the disease to be immunized against.

The exact immunostimulatory CpG motif(s) to be added will depend on the ultimate purpose of the vector. If it is to be used for prophylactic vaccination, preferable motifs stimulate humoral and/or cell-mediated immunity, depending on what would be most protective for the disease in question. It the DNA vaccine is for therapeutic purposes, such as for the treatment of a chronic viral infection, then motifs which preferentially induce cell-mediated immunity and/or a particular cytokine profile is added to the cassette.

The choice of motifs also depends on the species to be immunized as different motifs are optimal in different species. Thus, there would be one set of cassettes for humans as well as cassettes for different companion and food-source animals which receive veterinary vaccination. There is a very strong correlation between certain in vitro immunostimulatory effects and in vivo adjuvant effect of specific CpG motifs. For example, the strength of the humoral response correlates very well (r>0.9) with the in vitro induction of TNF-.alpha., IL-6, IL-12 and B-cell proliferation. On the other hand, the strength of the cytotoxic T-cell response correlates well with in vitro induction of IFN-.gamma..

Since the entire purpose of DNA vaccines is to enhance immune responses, which necessarily includes cytokines, the preferred promoter is not down-regulated by cytokines. For example, the CMV immediate early promoter/enhancer, which is used in almost all DNA vaccines today, is turned off by IFN-.alpha. and IFN-.gamma. (Gribaudo et al., Virology. 197: 303-311, 1993; Harms & Splitter, Human Gene Ther. 6: 1291-1297, 1995; Xiang et al., Vaccine, 15: 896-898, 1997). Another example is the down-regulation of a hepatitis B viral promoter in the liver of HBsAg-expressing transgenic mice by IFN-.gamma. and TNF-.alpha. (Guidotti et al., Proc. Natl. Acad. Sci. USA. 91: 3764-3768, 1994).

Nevertheless, such viral promoters may still be used for DNA vaccines as they are very strong, they work in several cell types, and despite the possibility of promoter turn-off, the duration of expression with these promoters has been shown to be sufficient for use in DNA vaccines (Davis et al., Human Molec. Genetics. 2: 1847-1851, 1993). The use of CpG-optimized DNA vaccine vectors could improve immune responses to antigen expressed for a limited duration, as with these viral promoters. When a strong viral promoter is desired, down-regulation of expression may be avoidable by choosing CpG-S motfis that do not induce the cytokine(s) that affect the promoter (Harms and Splitter, 1995 supra).

Other preferable promoters for use as described herein are eukaryotic promoters. Such promoters can be cell- or tissue-specific. Preferred cells/tissues for high antigen expression are those which can act as professional antigen presenting cells (APC) (e.g., macrophages, dendritic cells), since these have been shown to be the only cell types that can induce immune responses following DNA-based immunization (Ulmer et al., 1996; Corr et al., J. Exp. Med., 184, 1555-1560, 1996; Doe et al., Proc. Natl. Acad. Sci. USA, 2, 8578-8583, 1996; Iwasaki et al., J. Immunol., 159: 11-141998). Examples of such a promoter are the mammalian MHC I or MHC II promoters.

The invention also includes the use of a promoter whose expression is up-regulated by cytokines. An example of this is the mammalian MHC I promoter that has the additional advantage of expressing in APC, which as discussed above is highly desirable. This promoter has also been shown to have enhanced expression with IFN-.gamma. (Harms & Splitter, 1995, supra).

After intramuscular injection of DNA vaccines, muscle fibers may be efficiently transfected and produce a relatively large amount of antigen that may be secreted or otherwise released (e.g., by cytolytic attack on the antigen-expressing muscle fibers)(Davis et al., Current Opinions Biotech. 8: 635-640, 1997). Even though antigen-expressing muscle fibers do not appear to induce immune responses from the point of view of antigen presentation, B-cells must meet circulating antigen to be activated, it is possible that antibody responses are augmented by antigen secreted or otherwise released from other cell types (e.g., myofibers, keratinocytes). This may be particularly true for conformational B-cell epitopes, which would not be conserved by peptides presented on APC. For this purpose, expression in muscle tissue is particularly desirable since myofibers are post-mitotic and the vector will not be lost through cell-division, thus antigen expression can continue until the antigen-expressing cell is destroyed by an immune repsonse against it. Thus, when strong humoral responses are desired, other preferred promoters are strong muscle-specific promoters such as the human muscle-specific creatine kinase promoter (Bartlett et al., 1996) and the rabbit .beta.-cardiac myosin heavy chain (full-length or truncated to 781 bp) plus the rat myosin light chain 1/3 enhancer.

In the case of DNA vaccines with muscle- or other non-APC tissue-specific promoters, it may be preferable to administer it in conjunction with a DNA vaccine encoding the same antigen but under the control of a promoter that will work strongly in APC (e.g., viral promoter or tissue specific for APC). In this way, optimal immune responses can be obtained by having good antigen presentation as well as sufficient antigen load to stimulate B-cells. A hybrid construct, such as the .beta.-actin promoter with the CMV enhancer (Niwa et al, Gene. 108: 193-199, 1991) is also desirable to circumvent some of the problems of strictly viral promoters.

While DNA vaccine vectors may include a signal sequence to direct secretion, humoral and cell-mediated responses are possible even when the antigen is not secreted. For example, it has been found in mice immunized with hepatitis B surface antigen (HBsAg)-expressing DNA that the appearance of anti-HBs antibodies is delayed for a few weeks if the HBsAg is not secreted (Michel et al., 1995). As well, antibodies are induced in rabbits following IM immunization with DNA containing the gene for cottontail rabbit papilloma virus major capsid protein (L1), which has a nuclear localization signal (Donnelly et al., 1996). In these cases, the B-cells may not be fully activated until the expressed antigen is released from transfected muscle (or other) cells upon lysis by antigen-specific CTL.

Preferably, the CpG-S motifs in the construct include a motif having the formula:

5'X₁ CGX₂ 3'

wherein at least one nucleotide separates consecutive CpGs, X₁ is adenine, guanine, or thymine and X₂ is cytosine, thymine, or adenine. Exemplary CpG-S oligonucleotide motifs include GACGTT, AGCGTT, AACGCT, GTCGTT and AACGAT. Another oligonucleotide useful in the construct contains TCAACGTT. Further exemplary oligonucleotides of the invention contain GTCG(T/C)T, TGACGTT, TGTCG(TIC)T, TCCATGTCGTTCCTGTCGTT (SEQ ID NO:1), TCCTGACGTTCCTGACGTT (SEQ ID NO:2) and TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:3).

Preferably CpG-N motifs contain direct repeats of CpG dinucleotides, CCG trinucleotides, CGG trinucleotides, CCGG tetranucleotides, CGCG tetranucleotides or a combination of any of these motifs. In addition, the neutralizing motifs of the invention may include oligos that contain a sequence motif that is a poly-G motif, which may contain at least about four Gs in a row or two G trimers, for example (Yaswen et al., Antisense Research and Development 3:67, 1993; Burgess et al., PNAS 92:4051, 1995).

In the present invention, the nucleic acid construct is preferably an expression vector. The term "expression vector" refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of genetic coding sequences. Polynucleotide sequence which encode polypeptides can be operatively linked to expression control sequences.

"Operatively linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. An expression control sequence operatively linked to a coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the expression control sequences. As used herein, the term "expression control sequences" refers to nucleic acid sequences that regulate the expression of a nucleic acid sequence to which it is operatively linked. Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence. Thus expression control sequences can include appropriate promoters, enhancers, transcription terminators, a start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.

The term "control sequences" is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. Expression control sequences can include a promoter.

The nucleic acid construct of the invention may include any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector (see e.g., Bitter et al., 1987, Methods in Enzymology 153:516-544). When cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the retrovirus long terminal repeat; the adenoviral late promoter; the vaccinia virus 7.5K promoter) may be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted polypeptide coding sequence.

Mammalian cell systems which utilize recombinant viruses or viral elements to direct expression may be engineered. For example, when using adenovirus expression vectors, the polypeptide coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. Alternatively, the vaccinia virus 7.5K promoter may be used. (e.g., see, Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. USA 79: 4927-4931). Of particular interest are vectors based on bovine papilloma virus which have the ability to replicate as extrachromosomal elements (Sarver, et al., 1981, Mol. Cell. Biol. 1: 486). Shortly after entry of this DNA into mouse cells, the plasmid replicates to about 100 to 200 copies per cell. Transcription of the inserted CDNA does not require integration of the plasmid into the host's chromosome, thereby yielding a high level of expression. These vectors can be used for stable expression by including a selectable marker in the plasmid, such as, for example, the neo gene. Alternatively, the retroviral genome can be modified for use as a vector capable of introducing and directing the expression of the gene of interest in host cells (Cone & Mulligan, 1984, Proc. Natl. Acad. Sci. USA 81:6349-6353). High level expression may also be achieved using inducible promoters, including, but not limited to, the metallothionine IIA promoter and heat shock promoters.

The polypeptide that acts as an antigen in the methods described herein refers to an immunogenic polypeptide antigen, group of antigens or peptides encoding particular epitopes.

A polynucleotide encoding such antigen(s) is inserted into the nucleic acid construct as described herein. For example, a nucleic acid sequence encoding an antigenic polypeptide derived from a virus, such as Hepatitis B virus (HBV) (e.g., HBV surface antigen), an antigen derived from a parasite, from a tumor, or a bacterial antigen, is cloned into the nucleic acid construct described herein. Virtually any antigen, groups of antigens, or antigenic epitopes, can be used in the construct. Other antigens, such as peptides that mimic nonpeptide antigens, such as polysaccharides, are included in the invention.

Gene transfer into eukaryotic cells can be carried out by direct (in vivo) or indirect (in vitro or ex vivo) means (Miller et al., A. D. Nature. 357: 455-460, 1992). The DNA vector can also be transferred in various forms and formulations. For example, pure plasmid DNA in an aqueous solution (also called "naked" DNA) can be delivered by direct gene transfer. Plasmid DNA can also be formulated with cationic and neutral lipids (liposomes) (Gregoriadis et al, 1996), microencapsulated (Mathiowitz et al., 1997), or encochleated (Mannino and Gould Fogerite, 1995) for either direct or indirect delivery. The DNA sequences can also be contained within a viral (e.g., adenoviral, retroviral, herpesvius, pox virus) vector, which can be used for either direct or indirect delivery.

DNA vaccines will preferably be administered by direct (in vivo) gene transfer. Naked DNA can be give by intramuscular (Davis et al., 1993), intradermal (Raz et al., 1994; Condon et al., 1996; Gramzinski et al., 1998), subcutaneous, intravenous (Yokoyama et al., 1996; Liu et al., 1997), intraarterial (Nabel et al., 1993) or buccal injection (Etchart et al., 1997; Hinkula et al., 1997). Plasmid DNA may be coated onto gold particles and introduced biolistically with a "gene-gun" into the epidermis if the skin or the oral or vaginal mucosae (Fynan et al. Proc. Natl. Acac. Sci. USA 29:11478, 1993; Tang et al, Nature 356:152, 1992; Fuller, et al., J. Med. Primatol. 25:236, 1996; Keller et al., Cancer Gene Ther., 3:186, 1996). DNA vaccine vectors may also be used in conjunction with various delivery systems. Liposomes have been used to deliver DNA vaccines by intramuscular injection (Gregoriadis et al., FEBS Lett.402:107, 1997) or into the respiratory system by non-invasive means such as intranasal inhalation (Fynan et al., supra). Other potential delivery systems include microencapsulation (Jones et al., 1998; Mathiowitz et al., 1997) or cochleates (Mannino et al., 1995, Lipid matrix-based vaccines for mucosal and systemic immunization. Vaccine Designs: The Subunit and Adjuvant Approach, M. F. Powell and M. J. Newman, eds., Pleum Press, New York, 363-387), which can be used for parenteral, intranasal (e.g., nasal spray) or oral (e.g., liquid, gelatin capsule, solid in food) delivery. DNA vaccines can also be injected directly into tumors or directly into lymphoid tissues (e.g., Peyer's patches in the gut wall). It is also possible to formulate the vector to target delivery to certain cell types, for example to APC. Targeting to APC such as dendritic cells is possible through atachment of a mannose moiety (dendritic cells have a high density of mannose receptors) or a ligand for one of the other receptors found preferentially on APC. There is no limitation as to the route that the DNA vaccine is delivered, nor the manner in which it is formulated as long as the cells that are transfected can express antigen in such a way that an immune response is induced.

It some cases it may be desirable to carry out ex-vivo gene transfer, in which case a number a methods are possible including physical methods such as microinjection, electroportion or calcium phosphate precipitation, or facilitated transfer methods such as liposomes or dendrimers, or through the use of viral vectors. In this case, the transfected cells would be subsequently administered to the subject so that the antigen they expressed could induce an immune response.

Nucleotide sequences in the nucleic acid construct can be intentionally manipulated to produce CpG-S sequences or to reduce the number of CpG-N sequences for immunization vectors, For example, site-directed mutagenesis can be utilized to produce a desired CpG motif Alternatively, a particular CpG motif can be synthesized and inserted into the nucleic acid construct. Further, one of skill in the art can produce double-stranded CpG oligos that have self-complementary ends that can be ligated together to form long chains or concatemers that can be ligated into a plasmid, for example. It will be apparent that the number of CpG motifs or CpG-containing oligos that can be concatenated will depend on the length of the individual oligos and can be readily determined by those of skill in the art without undue experimentation. After formation of concatemers, multiple oligos can be cloned into a vector for use in the methods of the invention.

In one embodiment, the invention provides a method for stimulating a protective immune response in a subject. The method includes administering to the subject an immunomostimulatory effective amount of a nucleic acid construct produced by removing neutralizing CpG (CpG-N) motifs and optionally inserting stimulatory CpG (CpG-S) motifs, thereby producing a nucleic acid construct having enhanced immunostimulatory efficacy and stimulating a protective immune response in the subject. The construct typically further includes regulatory sequences for expression of DNA in eukaryotic cells and nucleic acid sequences encoding at least one polypeptide.

It is envisioned that methods of the present invention can be used to prevent or treat bacterial, viral, parasitic or other disease states, including tumors, in a subject. The subject can be a human or may be a non-human such as a pig, cow, sheep, horse, dog, cat, fish, chicken, for example. Generally, the terms "treating," "treatment," and the like are used herein to mean obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a particular infection or disease (e.g., bacterial, viral or parasitic disease or cancer) or sign or symptom thereof, and/or may be therapeutic in terms of a partial or complete cure for an infection or disease and/or adverse effect attributable to the infection or disease. "Treating" as used herein covers any treatment of (e.g., complete or partial), or prevention of, an infection or disease in a non-human, such as a mammal, or more particularly a human, and includes:

(a) preventing the disease from occurring in a subject that may be at risk of becoming infected by a pathogen or that may be predisposed to a disease (e.g., cancer) but has not yet been diagnosed as having it;

(b) inhibiting the infection or disease, i.e., arresting its development; or

Delivery of polynucleotides can be achieved using a plasmid vector as described herein, that can be administered as "naked DNA" (i.e., in an aqueous solution), formulated with a delivery system (e.g., liposome, cochelates, microencapsulated), or coated onto gold particles. Delivery of polynucleotides can also be achieved using recombinant expression vectors such as a chimeric virus. Thus the invention includes a nucleic acid construct as described herein as a pharmaceutical composition useful for allowing transfection of some cells with the DNA vector such that antigen will be expressed and induce a protective (to prevent infection) or a therapeutic (to ameliorate symptoms attributable to infection or disease) immune response. The pharmaceutical compositions according to the invention are prepared by bringing the construct according to the present invention into a form suitable for administration to a subject using solvents, carriers, delivery systems, excipients, and additives or auxiliaries. Frequently used solvents include sterile water and saline (buffered or not). A frequently used carrier includes gold particles, which are delivered biolistically (i.e., under gas pressure). Other frequently used carriers or delivery systems include cationic liposomes, cochleates and microcapsules, which may be given as a liquid, solution, enclosed within a delivery capsule or incorporated into food.

The pharmaceutical compositions are preferably prepared and administered in dose units. Liquid dose units would be injectable solutions or nasal sprays or liquids to be instilled (e.g., into the vagina) or swallowed or applied onto the skin (e.g. with allergy tines, with tattoo needles or with a dermal patch). Solid dose units would be DNA-coated gold particles, creams applied to the skin or formulations incorporated into food or capsules or embedded under the skin or mucosae or pressed into the skin (e.g., with allergy tines). Different doses will be required depending on the activity of the compound, form and formulation, manner of administration, and age or size of patient (i.e., pediatric versus adult), purpose (prophylactic vs therapeutic). Doses will be given at appropriate intervals, separated by weeks or months, depending on the application. Under certain circumstances higher or lower, or more frequent or less frequent doses may be appropriate. The administration of a dose at a single time point may be carried out as a single administration or a multiple administration (e.g. several sites with gene-gun or for intradermal injection or different routes). Whether the pharmaceutical composition is delivered locally or systemically, it will induce systemic immune responses. By "therapeutically effective dose" is meant the quantity of a vector or construct according to the invention necessary to induce an immune response that can prevent, cure, or at least partially arrest the symptoms of the disease and its complications. Amounts effective for this will of course depend on the mode of administration, the age of the patient (pediatric versus adult) and the disease state of the patient. Animal models may be used to determine effective doses for the induction of particular immune responses and in some cases for the prevention or treatment of particular diseases.

The term "effective amount" of a nucleic acid molecule refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a nucleic acid construct containing at least one unmethylated CpG for treating a disorder could be that amount necessary to induce an immune response of sufficient magnitude to eliminate a tumor, cancer, or bacterial, parasitic, viral or fungal infection. An effective amount for use as a vaccine could be that amount useful for priming and boosting a protective immune response in a subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular nucleic acid being administered (e.g. the number of unmethylated CpG motifs (-S or -N) or their location in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular oligonucleotide without necessitating undue experimentation. An effective amount for use as a prophylactic vaccine is that amount useful for priming and boosting a protective immune response in a subject.

In one embodiment, the invention provides a nucleic acid construct containing CpG motifs as described herein as a pharmaceutical composition useful for inducing an immune response to a bacterial, parasitic, fungal, viral infection, or the like, or to a tumor in a subject, comprising an immunologically effective amount of nucleic acid construct of the invention in a pharmaceutically acceptable carrier. "Administering" the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. By "subject" is meant any animal, preferably a mammal, most preferably a human. The term "immunogenically effective amount," as used in describing the invention, is meant to denote that amount of nucleic acid construct which is necessary to induce, in an animal, the production of a protective immune response to the bacteria, fungus, virus, tumor, or antigen in general.

In addition to the diluent or carrier, such compositions can include adjuvants or additional nucleic acid constructs that express adjuvants such as cytokines or co-stimulatory molecules. Adjuvants include CpG motifs such as those described in co-pending application Ser. No. 09/030,701.

The method of the invention also includes slow release nucleic acid delivery systems such as microencapsulation of the nucleic acid constructs or incorporation of the nucleic acid constructs into liposomes. Such particulate delivery systems may be taken up by the liver and spleen and are easily phagocytosed by macrophages. These delivery systems also allow co-entrapment of other immunomodulatory molecules, or nucleic acid constructs encoding other immunomodulatory molecules, along with the antigen-encoding nucleic acid construct, so that modulating molecules may be delivered to the site of antigen synthesis and antigen processing, allowing modulation of the immune system towards protective responses.

Many different techniques exist for the timing of the immunizations when a multiple immunization regimen is utilized. It is possible to use the antigenic preparation of the invention more than once to increase the levels and diversity of expression of the immune response of the immunized animal. Typically, if multiple immunizations are given, they will be spaced about four or more weeks apart. As discussed, subjects in which an immune response to a pathogen or cancer is desirable include humans, dogs, cattle, horses, deer, mice, goats, pigs, chickens, fish, and sheep.

Examples of infectious virus to which stimulation of a protective immune response is desirable include: Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g., Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes viruses'); Poxrviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g., African swine fever virus); and unclassified viruses (e.g., the etiological agents of Spongiform encephalopathies, the agent of delta hepatities (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class 1=internally transmitted; class 2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related viruses, and astroviruses).

Examples of infectious bacteria to which stimulation of a protective immune response is desirable include: Helicobacier pylons, Borellia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus antracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostindiuim perfringers, Clostridium tetani, Enterobacter aerogenes. Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, and Actinomyces israelli.

Examples of infectious fungi to which stimulation of a protective immune response is desirable include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (i.e., protists) include: Plasmodium falciparum and Toxoplasma gondii.

An "immunostimulatory nucleic acid molecule" or oligonucleotide as used herein refers to a nucleic acid molecule, which contains an unmethylated cytosine, guanine dinucleotide sequence (i.e. "CpG DNA" or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates (e.g. has a mitogenic effect on, or induces or increases cytokine expression by) a vertebrate lymphocyte. An immunostimulatory nucleic acid molecule can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules may have increased immune activity.

Unmethylated immunostimulatory CpG motifs, either within a nucleic acid construct or an oligonucleotide, directly activate lymphocytes and co-stimulate antigen-specific responses. As such, they are fundamentally different form aluminum precipitates (alum), currently the only adjuvant licensed for human use, which is thought to act largely through adsorbing the antigen thereby maintaining it available to immune cells for a longer period. Further, alum cannot be added to all types of antigens (e.g., live attentuated pathogens, some multivalent vaccines), and it induces primarily Th2 type immune responses, namely humoral immunity but rarely CTL. For many pathogens, a humoral response alone is insufficient for protection, and for some pathogens can even be detrimental.

In addition, an immunostimulatory oligonucleotide in the nucleic acid construct of the invention can be administered prior to, along with or after administration of a chemotherapy or other immunotherapy to increase the responsiveness of malignant cells to subsequent chemotherapy or immunotherapy or to speed the recovery of the bone marrow through induction of restorative cytokines such as GM-CSF. CpG nucleic acids also increase natural killer cell lytic activity and antibody dependent cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may likewise be beneficial in cancer immunotherapy, alone or in conjunction with other treatments.

Gene Therapy

Plasmid or vector DNA may also be useful for certain gene therapy applications. In most such cases, an immune response against the encoded gene product would not be desirable. Thus, the optimal plasmid DNA cassette for gene therapy purposes will have all possible immunostimulatory (CpG-S) motifs removed and several immunoinhibitory (CpG-N) motifs added in. An exemplary vector for gene therapy purposes is described in the Examples.

Despite comparable levels of unmethylated CpG dinucleotides, DNA from serotype 12 adenovirus is immune stimulatory, but serotype 2 is nonstimulatory and can even inhibit activation by bacterial DNA. In type 12 genomes, the distribution of CpG-flanking bases is similar to that predicted by chance. However, in type 2 adenoviral DNA the immune stimulatory CpG-S motifs are outnumbered by a 15 to 30 fold excess of CpG dinucleotides in clusters of direct repeats or with a C on the 5' side or a G on the 3' side. Synthetic oligodeoxynucleotides containing these putative neutralizing (CpG-N) motifs block immune activation by CpG-S motifs in vitro and in vivo. Eliminating 52 of the 134 CpG-N motifs present in a DNA vaccine markedly enhanced its Th1-like function in vivo, which was further increased by addition of CpG-S motifs. Thus, depending on the CpG motif, prokaryotic DNA can be either immune-stimulatory or neutralizing. These results have important implications for understanding microbial pathogenesis and molecular evolution, and for the clinical development of DNA vaccines and gene therapy vectors.

Gene therapy, like DNA-based immunization, involves introduction of new genes into cells of the body, where they will be expressed to make a desired protein. However, in contrast to DNA vaccines, an immune response against the expressed gene product is not desired for gene therapy purposes. Rather, prolonged expression of the gene product is desired to augment or replace the function of a defective gene, and thus immune responses against the gene product are definitely undesirable.

Plasmid DNA expression vectors are also used for gene therapy approaches. They may be preferable to viral vectors (i.e., recombinant adenovirus or retrovirus), which themselves are immunogenic (Newman, K. D., et al., J. Clin. Invest., 96:2955-2965, 1995; Zabner, J., et al., J. Clin. Invest., 97:1504-1511, 1996). Immune responses directed against such vectors may interfere with successful gene transfer if the same vector is used more than once. Double-stranded DNA is poorly immunogenic (Pisetsky, D. S. Antisense Res. Devel. 5: 219-225, 1995; Pisetsky, D. S. J Immunol. 156: 421-423, 1996), and thus from this perspective, repeated use is not a problem with plasmid DNA.

Nevertheless, even when gene transfer is carried out with plasmid DNA vectors, expression of the introduced gene is often short-lived and this appears to be due to immune responses against the expressed protein (Miller, A. D. Nature. 357: 455-460, 1992; Lasic, D. D., and Templeton, N. S. Advanced Drug Delivery Review. 20: 221-266, 1996). It is not a surprise that expression of a foreign protein, as is the case with gene replacement strategies, induces immune responses. Nevertheless, it is likely that the presence of CpG-S motifs aggravates this situation. The finding that removal of CpG-S motifs from DNA vaccines can abolish their efficacy suggests that such a strategy may prove useful for creating gene therapy vectors where immune responses against the encoded protein are undesirable. Furthermore, the more recent discovery of CpG-N motifs opens up the possibility of actually abrogating unwanted immune responses through incorporating such motifs into gene delivery vectors. In particular, the Th-2 bias of CpG-N motifs may prevent induction of cytotoxic T-cells, which are likely the primary mechanism for destruction of transfected cells.

In another embodiment, the invention provides a method for enhancing the expression of a therapeutic polypeptide in vivo wherein the polypeptide is contained in a nucleic acid construct. The construct is produced by removing stimulatory CpG (CpG-S) motifs and optionally inserting neutralizing CpG (CpG-N) motifs, thereby producing a nucleic acid construct providing enhanced expression of the therapeutic polypeptide. Alternatively, the invention envisions using the construct for delivery of antisense polynucleotides or ribozymes.

Typical CpG-S motifs that are removed from the construct include a motif having the formula:

5'X₁ CGX₂ 3'

wherein at least one nucleotide separates consecutive CpGs, X₁ is adenine, guanine, or thymine and X₂ is cytosine, thymine, or adenine. Exemplary CpG-S oligonucleotide motifs include GACGTT, AGCGTT, AACGCT, GTCGTT and AACGAT. Another oligonucleotide useful in the construct contains TCAACGTT. Further exemplary oligonucleotides of the invention contain GTCG(T/C)T, TGACGTT, TGTCG(T/C)T, TCCATGTCGTICCTGTCGTT (SEQ ID NO:1), TCCTGACGTTCCTGACGTT (SEQ ID NO:2) and TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:3). These motifs can be removed by site-directed mutagenesis, for example.

The present invention provides gene therapy vectors and methods of use. Such therapy would achieve its therapeutic effect by introduction of a specific sense or antisense polynucleotide into cells or tissues affected by a genetic or other disease. It is also possible to introduce genetic sequences into a different cell or tissue than that affected by the disease, with the aim that the gene product will have direct or indirect impact on the diseases cells or tissues. Delivery of polynucleotides can be achieved using a plasmid vector as described herein (in "naked" or formulated form) or a recombinant expression vector (e.g., a chimeric vector).

For long-term, high-yield production of recombinant proteins, stable expression is preferred. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with a heterologous cDNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. The selectable marker in a recombinant plasmid or vector confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. For example, following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026), and adenine phosphoribosyltransferase (Lowvy, et al., 1980, Cell 22: 817) genes can be employed in tk-, hgprt^- or aprt^- cells respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77: 3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072; neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150: 1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30: 147) genes. Recently, additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85: 8047); and ODC (ornithine decarboxylase) which confers resistance to the ornithine decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine, DFMO (McConlogue L., 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.).

Various viral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or, preferably, an RNA virus such as a retrovirus. Preferably, the retroviral vector is a derivative of a murine or avian retrovirus. Examples of retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV). When the subject is a human, a vector such as the gibbon ape leukemia virus (GaLV) can be utilized. A number of additional retroviral vectors can incorporate multiple genes. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated.

Therapeutic peptides or polypeptides are typically included in the vector for gene therapy. For example, immunomodulatory agents and other biological response modifiers can be administered for incorporation by a cell. The term "biological response modifiers" is meant to encompass substances which are involved in modifying the immune response. Examples of immune response modifiers include such compounds as lymphokines. Lymphokines include tumor necrosis factor, interleukins (e.g., IL-2, -4, -6, -10 and -12), lymphotoxin, macrophage activating factor, migration inhibition factor, colony stimulating factor, and alpha-interferon, beta-interferon, and gamma-interferon and their subtypes. Also included are polynucleotides which encode metabolic enzymes and proteins, including Factor VIII or Factor IX. Other therapeutic polypeptides include the cystic fibrosis transmembrane conductance regulator (e.g., to treat cystic fibrosis); structural or soluble muscle proteins such as dystrophin (e.g., to treat muscular dystrophies); or hormones. In addition, suicide or tumor repressor genes can be utilized in a gene therapy vector described herein.

In addition, antisense polynucleotides can be incorporated into the nucleic acid construct of the invention. Antisense polynucleotides in context of the present invention includes both short sequences of DNA known as oligonucleotides of usually 10-50 bases in length as well as longer sequences of DNA that may exceed the length of the target gene sequence itself. Antisense polynucleotides useful for the present invention are complementary to specific regions of a corresponding target mRNA. Hybridization of antisense polynucleotides to their target transcripts can be highly specific as a result of complementary base pairing.

Transcriptional regulatory sequences include a promoter region sufficient to direct the initiation of RNA synthesis. Suitable eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al., J. Molec. Appl. Genet. 1: 273 (1982)); the TK promoter of Herpes virus (McKnight, Cell 31: 355 (1982); the SV40 early promoter (Benoist et al., Nature 290: 304 (1981); the Rous sarcoma virus promoter (Gorman et al., Proc. Nat'l Acad. Sci. USA 79: 6777 (1982); and the cytomegalovirus promoter (Foecking et al., Gene 45: 101 (1980)) (See also discussion above for suitable promoters).

Alternatively, a prokaryotic promoter, such as the bacteriophage T3 RNA polymerase promoter, can be used to control fusion gene expression if the prokaryotic promoter is regulated by a eukaryotic promoter. Zhou et al., Mol. Cell. Biol. 10: 4529 (1990); Kaufman et al., Nucl. Acids Res. 19: 4485 (1991).

It is desirable to avoid promoters that work well in APC since that could induce an immune response. Thus, ubiquitous viral promoters, such as CMV, should be avoided. Promoters specific for the cell type requiring the gene therapy are desirable in many instances. For example, with cystic fibrosis, it would be best to have a promoter specific for the lung epithelium. In a situation where a particular cell type is used as a platform to produce therapeutic proteins destined for another site (for either direct or indirect action), then the chosen promoter should work well in the "factory" site. Muscle is a good example for this, as it is post-mitotic, it could produce therapeutic proteins for years on end as long as there is no immune response against the protein-expressing muscle fibers . Therefore, use of strong muscle promoters as described in the previous section are particularly applicable here. Except for treating a muscle disease per se, use of muscle is typically only suitable where there is a secreted protein so that it can circulate and function elsewhere (e.g., hormones, growth factors, clotting factors).

Administration of gene therapy vectors to a subject, either as a plasmid or as part of a viral vector can be affected by many different routes. Plasmid DNA can be "naked" or formulated with cationic and neutral lipids (liposomes), microencapsulated, or encochleated for either direct or indirect delivery. The DNA sequences can also be contained within a viral (e.g., adenoviral, retroviral, herpesvius, pox virus) vector, which can be used for either direct or indirect delivery. Delivery routes include but are not limited to intramuscular, intradermal (Sato, Y. et al., Science 273: 352-354, 1996), intravenous, intra-arterial, intrathecal, intrahepatic, inhalation, intravaginal instillation (Bagarazzi et al., J. Med. Primatol. 26:27, 1997), intrarectal, intratumor or intraperitoneal.

As much as 4.4 mg/kg/d of antisense polynucleotide has been administered intravenously to a patient over a course of time without signs of toxicity. Martin, 1998, "Early clinical trials with GDM91, a systemic oligodeoxynucleotide", In: Applied Oligonucleotide Technology, C A. Stein and A. M. Krieg, (Eds.), John Wiley and Sons, Inc., New York, N.Y.). Also see Sterling, "Systemic Antisense Treatment Reported," Genetic Engineering News 12: 1, 28 (1992).

Delivery of polynucleotides can be achieved using a plasmid vector as described herein, that can be administered as "naked DNA" (i.e., in an aqueous solution), formulated with a delivery system (e.g., liposome, cochelates, microencapsulated). Delivery of polynucleotides can also be achieved using recombinant expression vectors such as a chimeric virus. Thus the invention includes a nucleic acid construct as described herein as a pharmaceutical composition useful for allowing transfection of some cells with the DNA vector such that a therapeutic polypeptide will be expressed and have a therapeutic effect (to ameliorate symptoms attributable to infection or disease). The pharmaceutical compositions according to the invention are prepared by bringing the construct according to the present invention into a form suitable for administration to a subject using solvents, carriers, delivery systems, excipients, and additives or auxiliaries. Frequently used solvents include sterile water and saline (buffered or not). One carrier includes gold particles, which are delivered biolistically (i.e., under gas pressure). Other frequently used carriers or delivery systems include cationic liposomes, cochleates and microcapsules, which may be given as a liquid solution, enclosed within a delivery capsule or incorporated into food.

An alternative formulation for the administration of gene therapy vectors involves liposomes. Liposome encapsulation provides an alternative formulation for the administration of polynucleotides and expression vectors. Liposomes are microscopic vesicles that consist of one or more lipid bilayers surrounding aqueous compartments. See, generally, Bakker-Woudenberg et al., Eur. J. Clin. Microbiol. Infect. Dis. 12 (Suppl. 1): S61 (1993), and. Kim, Drugs 46: 618 (1993). Liposomes are similar in composition to cellular membranes and as a result, liposomes can be administered safely and are biodegradable. Depending on the method of preparation, liposomes may be unilamellar or multilamellar, and liposomes can vary in size with diameters ranging from 0.02 .mu.m to greater than 10 .mu.m. See, for example, Machy et al., LIPOSOMES IN CELL BIOLOGY AND PHARMACOLOGY (John Libbey 1987), and Ostro et al., American J. Hosp. Pharm. 46: 1576 (1989).

After intravenous administration, conventional liposomes are preferentially phagocytosed into the reticuloendothelial system. However, the reticuloendothelial system can be circumvented by several methods including saturation with large doses of liposome particles, or selective macrophage inactivation by pharmacological means. Claassen et al., Biochim. Biophys. Acta 802: 428 (1984). In addition, incorporation of glycolipid- or polyethelene glycol-derivatised phospholipids into liposome membranes has been shown to result in a significantly reduced uptake by the reticuloendothelial system. Allen et al., Biochim. Biophlys. Acta 1068: 133 (1991); Allen et al., Biochim. Biohys. Acta 1150: 9 (1993). These Stealth.RTM. liposomes have an increased circulation time and an improved targeting to tumors in animals. (Woodle et al., Proc. Amer. Assoc. Cancer Res. 33: 2672 1992). Human clinical trials are in progress, including Phase III clinical trials against Kaposi's sarcoma. (Gregoriadis et al., Drugs 45: 15, 1993).

Expression vectors can be encapsulated within liposomes using standard techniques. A variety of different liposome compositions and methods for synthesis are known to those of skill in the art. See, for example, U.S. Pat. Nos. 4,844,904, 5,000,959, 4,863,740, 5,589,466, 5,580,859, and 4,975,282, all of which are hereby incorporated by reference.

Liposomes can be prepared for targeting to particular cells or organs by varying phospholipid composition or by inserting receptors or ligands into the liposomes. For instance, antibodies specific to tumor associated antigens may be incorporated into liposomes, together with gene therapy vectors, to target the liposome more effectively to the tumor cells. See, for example, Zelphati et al., Antisense Research and Development 3: 323-338 (1993), describing the use "immunoliposomes" containing vectors for human therapy.

In general, the dosage of administered liposome-encapsulated vectors will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. Dose ranges for particular formulations can be determined by using a suitable animal model.

In addition to antisense, ribozymes can be utilized with the gene therapy vectors described herein. Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J.Amer.Med. Assn., 260:3030, 1988). A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.

There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff, Nature, 334:585, 1988) and "hammerhead"-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while "hammerhead"-type ribozymes recognize base sequences 11-18 bases in length. The longer the recognition sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating a specific mRNA species and 18-based recognition sequences are preferable to shorter recognition sequences.

Claim 1 of 48 Claims

What is claimed is:

1. A method of producing a nucleic acid construct that provides enhanced expression of a polypeptide in a mammalian or avian subject, the method comprising the steps of:

(a) determining the presence of one or more immunostimulatory unmethylated CpG motifs (CpG-S motifs) in a nucleic acid construct encoding a polypeptide; and,

(b) modifying the nucleic acid construct by:

(i) removing one or more CpG-S motifs from the nucleic acid construct; and/or

(ii) inserting one or more neutralizing CyG motifs (CpG-N motifs) into the nucleic acid construct,

wherein the modifying step (b) is performed on one or more non-essential regions of the nucleic acid construct, and/or wherein the modifying step (b) introduces one or more silent mutations into the nucleic acid construct,

thereby producing a nucleic acid construct providing enhanced expression of the polypeptide.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]