|
|

Link:
Pharm/Biotech Resources
Title: Laminin chains: diagnostic uses
United States Patent: 6,955,924
Issued: October 18, 2005
Inventors: Tryggvason; Karl (Oulu, FI); Kallunki; Pekka (La
Jolla, CA); Pyke; Charles (Hilleroo, DK)
Assignee: BioStratum, Inc. (Durham, NC)
Appl. No.: 756071
Filed: January 8, 2001
Abstract
The instant invention provides for the identification, diagnosis,
monitoring, and treatment of invasive cells using the laminin 5 gamma-2
chain protein or nucleic acid sequence, or antibodies thereto.
SUMMARY OF THE INVENTION
The instant invention provides for methods of detecting kalinin/laminin 5
expression in tissue comprising detecting a signal from assayed tissue, such
signal resulting from specifically hybridizing tissue with an effective
amount of a nucleic acid probe, which probe contains a sense or antisense
portion of kalinin/laminin 5 gamma-2 nucleic acid sequence (Kallunki et al.,
1992, supra.). In particular, where the nucleic acid probe is DNA, RNA,
radio-labeled, enzyme labeled, chemiluminescent labeled, avidin or biotin
labeled, derived from human kalinin/laminin 5 gamma-2 nucleic acid sequence,
incorporated into an extrachromasomal self-replicating vector, a viral
vector, is linear, circularized, or contains modified nucleotides. In the
preferred embodiment the probes are linearized specific regions of the γ-2
gene.
The instant invention also provides for methods for detecting the presence
of invasive cells in tissue comprising detecting a signal from assayed
tissue, such signal resulting from contacting tissue with an effective
amount of a nucleic acid probe, which probe contains a sense or antisense
portion of kalinin/laminin 5 γ-2 nucleic acid sequence (Kallunki et al.,
1992, supra.). In particular, where the nucleic acid probe is DNA, RNA,
radio-labeled, enzyme labeled, chemiluminescent labeled, avidin or biotin
labeled, derived from human kalinin/laminin 5 gamma-2 nucleic acid sequence,
incorporated into an extrachromasomal self-replicating vector, a viral
vector, is linear, circularized, or contains modified nucleotides. In the
preferred embodiment the probes are linearized specific regions of the γ-2
gene. The instant method also provides for the diagnosis of the absence of
γ-2 chain expression, useful for the monitoring of therapies, and the
progress of malignant cell transformation leading to accurate determination
of the extent of invasive cell activity.
The instant invention further provides for a method for detecting kalinin/laminin
5 expression in tissue comprising detecting a signal from assayed tissue,
such signal resulting from contacting tissue with an effective amount of a
labeled probe, which probe contains an antibody immunoreactive with a
portion of kalinin/laminin 5 gamma-2 protein.
Further provided is a method for detecting invasive cells in tissue
comprising detecting a signal from assayed tissue, such signal resulting
from contacting tissue with an effective amount of a labeled probe, which
probe contains an antibody immunoreactive with a portion of kalinin/laminin
5 gamma-2 protein. Also provided is a method for detecting kalinin/laminin 5
in tissue comprising detecting a signal from assayed tissue, such signal
resulting from contacting tissue with an effective amount of a labeled
probe, which probe contains an antibody immunoreactive with a potion of
kalinin/laminin 5 gamma-2 protein. Thus the method of the instant invention
provides for the absence of such signal as diagnostic for the absence of
invasive cells.
Further, the present invention provides for a method of using the laminin-5
molecule to promote adhesion of cultured epithelial and carcinoma cells.
Additionally, the present invention is directed to a method for blocking
migration of cells using antibodies against the γ-2 chain of the laminin-5
molecule. Evidence for the relationship of γ2 chain expression with cell
migration was obtained by the identification of an enhancer element in the
LAMC2 gene in studies on promoter-reporter gene constructs in transgenic
mice.
DETAILED DESCRIPTION OF THE INVENTION
Epidermolysis bullosa (EB) is a group of mechano-bullous disorders
characterized by fragility of the skin and mucous membranes (see Lin &
Carter eds., Epidermolysis bullosa. Basic and clinical aspects, 1992,
Springer Verlag, N.Y.; Fine et al., J. Am. Acad. Dermatol., 1991,
24:119-135). The junctional forms of EB (JEB) are characterized by tissue
separation at the level of the lamina lucida within the dermal-epidermal
basement membrane, and no specific mutation had yet to be reported. Recently
it has been proposed that the genes for a lamina lucida protein kalinin/nicein/epiligin
may be a candidate in some forms of JEB (Verrando et al., 1991, supra.).
Several lines of evidence suggest that anchoring filament proteins could be
defective in some forms of JEB. First, attenuation or absence of
immunoreactivity with anti-kalinin(epiligrin) antibodies has been noted in
the skin of patients with the most severe (Herlitz) type of JEB. The
immunofluorescence staining patterns may be of prognostic value in
classifying JEB, and these immunoreagents have been used for prenatal
diagnosis of JEB using fetal skin biopsy specimens. Second, the kalinin/laminin
5 γ-2 chain is expressed in epithelial cells of the skin, trachea and
kidneys, tissues which are frequently affected by JEB.
Since the majority of cases are of the generalized (Herlitz) phenotype (H-JEB),
JEB patients have been classified into Herlitz and non-Herlitz types.
Clinical features of H-JEB include mechanical fragility of the skin, with
widespread blistering and erosions, rapid deterioration and neonatal death,
often from sepsis. Longterm survival is rare.
Efforts to identify the basic defect in JEB began with the observation that
a monoclonal antibody that binds to the lamina lucida of the epidermal
basement membrane zone of normal skin, fails to react with the lamina lucida
of H-JEB skin (Verrando et al., 1991, supra.). The antigen recognized by
this antibody was purified from keratinocyte culture medium and termed
BM600/nicein. Keratinocytes cultured from the skin of H-JEB patients attach
poorly to substrate and fail to accumulate immunologically detectable nicein.
Further experiments with antibodies specific for the α3 chain of nicein,
demonstrated that they were capable of inducing the rounding and detachment
of adherent keratinocytes without affecting fibroblasts (Rousselle et al.,
1991, supra.). Thus the correlation in vivo and in vitro of the
dermoepidermal separation with deficient nicein/kalinin/laminin 5
immunoreactivity and the separation induced by anti-nicein antibody have
made the genes encoding this protein strong candidates for the site of H-JEB
mutations.
The importance of the γ-2 chain of nicein/kalinin/laminin 5 in JEB, and
epithelial tissues prompted the investigation into the role such adhesion
contacts between epithelial cells may play in abberant cells. Of primary
interest was the role γ-2 chain of nicein/kalinin/laminin 5 abberant
expression may play in cancer tissue, and a possible role in cancer
dissemination.
It has been recently shown that in colon adenocarcinoma, a significant
positive correlation between the degree of tumor budding and the recurrence
of tumors following curative surgery exists, and that this fact is likely to
reflect a higher invasive potential of budding cancer cells as compared with
cancer cells located deeper in the tumor (Hase et al., Dis. Colon Rectum,
1993, 36:627-635). Therefore, as demonstrated in Example 3 below, the
instant invention allows for the useful prognostic determination of success
of surgery, means for monitoring progression of rumor budding and subsequent
prognosis.
The identification of the role of γ-2 chain allows for the novel use of
kalinin/laminin 5 γ-2 chain and its ligand, as diagnostic probes of the
tumor cell/basement membrane adhesion interface that is crucial for the
invasion of non-malignant tissues, and identifies invasive cells.
Thus the identification of the role of γ-2 chain allows for the novel
therapeutic intervention of binding of kalinin/laminin 5 to its ligand, and
thereby reducing the tumor cell/basement membrane adhesion that is crucial
for the invasion of non-malignant tissues, and method for inhibiting the
budding of tumor masses, and a means for determing the level of γ-2 chain
expression as a measure of budding activity of a given tumor.
As demonstrated in Example 3 below, the γ-2 chain of kalinin/laminin 5 is
preferentially expressed by invasively growing malignant cells in human
carcinomas. Furthermore, migrating keratinocytes in wound healing also
expressed this gene, pointing to a role of γ-2 chain in epithelial cell
migration both in malignant and in nonmalignant pathological conditions. The
consistent expression of the γ-2 chain gene in invading cancer cells
reflects a functional importance of this molecule in vivo in establishing
contacts between the invading malignant cells and a provisional matrix in
the immediate surroundings of the cancer cells. The instant invention
provides methods for the identification of, and diagnosis of invasive cells
and tissues, and for the monitoring of the progress of therapeutic
treatments.
In a preferred embodiment of this aspect of the instant invention the
nucleic acid probe comprise a specifically hybridizing fragment of the γ-2
chain cDNA nucleic acid sequence. In this embodiment, the nucleic acid
sequence comprises all or a specifically hybridizing fragment of an open
reading frame of the nucleic acid sequence for the γ-2 chain (FIG. 4)
encoding the amino acid sequence of the γ-2 chain (FIG. 4). It will
be understood that the term "specifically hybridizing" when used to describe
a fragment of nueleic acid encoding a human laminin γ-2 chain gene is
intended to mean that, nueleic acid hybridization of such a fragment is
stable under high stringency conditions of hybridization and washing as the
term "high stringency" would be understood by those having skill in the
molecular biological arts.
Further, the instant invention provides for the therapeutic treatment of
such invasive tissues by using γ-2 chain or biologically active fragments
thereof to interfere with the interactions between abberant γ-2 chain and
surrounding tissues. The instant invention also provides for the
intervention of γ-2 chain interaction with surrounding tissues by using
specific anti-γ-2 chain antibodies (monoclonal or polyclonal) to inhibit the
γ-2 chain biological activity.
The instant disclosure also allows one to ablate the invasive cell
phenotypic γ-2 chain expression by using genetic manipulation to "knock-out"
the functional expression of the γ-2 chain gene in cancer cells, or to
completely "knock-out" the functional γ-2 chain gene in the genome of cancer
cells. Such knock-outs can be accomplished by using genetic molecular
biological techniques for inserting by homologous recombination into genomic
DNA, targeted transposon insertion, or random insertion/deletion mutations
in the genomic DNA.
The instant disclosure also allows for the therapeutic treatment of invasive
cell phenotype by the inhibition of functional γ-2 chain expression in
targeted cells by using anti-sense technology, such methods for anti-sense
production, stabilization, delivery, and therapeutic approaches are reviewed
in Uhlmann et al., 1990, Chem. Reviews 90:543-584).
Moreover, the present invention is also directed to two important functional
aspects of the epithelium specific laminin-5, i.e. cell adhesion and
migration. First of all, according to the present invention, the γ2 subunit
chain, as such, does not promote cell adhesion and, secondly, the laminin-5
isoform and its γ2 chain subunit play a role in the migratory process of
cells of epithelial origin. According to the present invention, the
migratory function of the γ2 chain is a characteristic for domain III, as
shown with antibody inhibition studies. Furthermore, involvement of the γ2
chain in cell migration was shown to be related with a cis-acting element in
LAMC2 gene, as studied in transgenic mice using promoter-reporter gene
constructs.
Thus the instant invention provides for a method of detection, diagnosis,
prognosis, monitoring, and therapeutic treatment of invasive cell
phenotypes.
The examples below are meant by way of illustration, and are not meant to be
limiting as to the scope of the instant disclosure.
EXAMPLE 1
Mutation in the γ2 Chain Gene LAMC2 is Critical in Some Cases of JEB
A unique scanning strategy using RT-PCR amplification of LAMC2 sequences was
devised to detect truncated forms of γ-2 chain gene transcripts (Pulkkinen
et al., Nature Genetics, 1994, 6:293-298). The 3.6 kilobase coding sequence
of the LAMC2 mRNA, was reverse transcribed and amplified with eight pairs of
primers, producing overlapping PCR amplimers designated A-H. The PCR
products were then examined by agarose gel electrophoresis, followed by MDE
heteroduplex analysis. If bands with altered mobility were detected, the PCR
products were sequenced, and compared with normal sequences from unaffected
family members or unrelated individuals. Intron/exon borders were identified
by PCR analysis of genomic DNA, deduced by comparison with cDNA sequences.
A Point Mutation Produces Exon Skipping
When a panel of five unrelated JEB patients were analysed, the primers used
to amplify segment C (nt 1046-1537) produced a markedly shortened band of
273 base pairs, as compared with the normal 491 base pairs. No evidence of
the normal sized band was noted, suggesting that the patient was homozygous
for this allele. Direct sequencing revealed that the shortened product
resulted from the deletion of 219 base pairs corresponding to nucleotides
1184-1402 in the cDNA, thus exon 9 was deleted. The remaining nucleotide
sequences within this and other PCR products did not reveal any additional
mutations upon MDE analysis.
Subsequent examination of the genomic DNA revealed that the sequences for
exons 8, 9 and 10 were present, however a homozygous G for A substitution at
the 3′ acceptor splice site at the junction of intron 8 and exon 9,
abolished the obligatory splice site sequence (AG).
Examination of another patient revealed that PCR product F (nt 2248-2777)
corresponding to domains I and II of the γ-2 chain, was a band with altered
mobility. Sequencing the abnormal product revealed a 20 bp deletion,
followed by a single base pair (G) insertion in the coding region
corresponding to exon 16. This mutation causes a frameshift which results in
a premature stop codon 51 base pairs downstream from the deletion-insertion,
producing a truncated kalinin/laminin 5 γ-2 chain terminating at residue
830.
RT-PCR and MDE Analyses
RNA isolated from fibroblast cell cultures of JEB patients was used as
template for RT-PCR of the LAMC2 mRNA. (Epidermal keratinocytes can also be
used). cDNA was prepared from 50 μg of total RNA in a volume of 100 μL
according to manufacturer's reccomendations (BRL), and oligonucleotide
primers were synthesized on the basis of the cDNA sequence (FIG. 4; Kallunki
et al., 1992, supra.), to generate about 500 base pair products, which
spanned the entire coding region.
For PCR amplification, 1 μL of cDNA was used as template and amplification
conditions were 94° C. for 5 min followed by 95° C. for 45 sec, 60° C. for
45 sec and 72° C. for 45 sec for 35 cycles in an OmniGene thermal cycler
(Marsh Scientific). Amplification was performed in a total volume of 25 μL
containing 1.5 mM MgCl.sub.2, and 2 U Taq polymerase (Boehringer Mannheim).
Aliquots of 5 μL were analysed on 2% agarose gels and MDE heteroduplex
analysis was performed according to the manufacturer's reccomendation (AT
Biochemicals). Heteroduplexes were visualized by staining with ethidium
bromide. If a band of altered mobility was detected in heteroduplex
analysis, the PCR product was subcloned into the TA vector (Invitrogen), and
sequenced by standard techniques.
DNA isolated either from fibroblast cultures or from specimens obtained from
buccal smears, was used as template for amplification of genomic sequences.
For amplification of introns 8 and 16, .about.500 ng of genomic DNA was used
as template and the following oligomer primers were utilized.
| 5′GGCTCACCAAGACTTACACA 3′ (SEQ ID NO:1); |
| 5′GAATCACTGAGCAGCTGAAC 3′ (SEQ ID NO:2); |
| 5′CAGTACCAGAACCGAGTTCG 3′ (SEQ ID NO:3); |
| 5′CTGGTTACCAGGCTTGAGAG 3′ (SEQ ID NO:4); |
| 5′TTACTGCGGAATCTCACAGC 3′ (SEQ ID NO:5); |
| 5′TACACTGTTCAACCCAGGGT 3′ (SEQ ID NO:6); |
| 5′AAACAAGCCCTCTCACTGGT 3′ (SEQ ID NO:7); |
| 5′GCGGAGACTGTGCTGATAAG 3′ (SEQ ID NO:8); |
| 5′CATACCTCTCTACATGGCAT 3′ (SEQ ID NO:9); |
| 5′AGTCTCGCTGAATCTCTCTT 3′ (SEQ ID NO:10); |
| 5′TTACAACTAGCATGGTGCCC 3′ (SEQ ID NO:11); |
Amplification conditions were 94° C. for 7 min followed by 95° C. for 1.5
min, 56° C. (intron 8) or 58° C. (intron 16) for 1 min and 72° C. for 1.5
min for 35 cycles in an OmniGene thermal cycler (Marsh Scientific).
Amplification was performed in a total volume of 25 μL containing 1.5 mM
MgCl.sub.2, and 2 U Taq polymerase (Boehringer Mannheim). The PCR products
were subcloned and sequenced as above.
Verification of Mutations
The putative mutations detected in the PCR products were verified at the
genomic level in both cases. For this purpose, a search for a potential
change in restriction endonuclease sites as a result of the mutation was
performed.
Amplification conditions were 94° C. for 7 min followed by 94° C. for 1 min,
58° C. for 45 sec and 72° C. for 45 sec for 35 cycles in an OmniGene thermal
cycler (Marsh Scientific). PCR products were analysed on 2.5% agarose gels.
The methods described allow for the screening of patients for mutations in
the γ-2 chain which will correlate with JEB. As demonstrated, the results
have identified a homozygous point mutation resulting in oxon skipping, and
a heterozygous deletion-insertion mutation. This demonstrating the effective
screening for, and identification of, γ2 chain mutations which correlate
with JEB. The methods are thus useful for diagnosis, prenatal screening,
early screening and detection, as well as detailed examination of JEB.
Further, the results show that the functional role of γ-2 chain expression
in epithelial cells is important in determining proper intercellular
connectivity, relating to the integrity of tissues and cell interactions.
EXAMPLE 2
Mutation in the γ-2 Chain Gene LAMC2 is Critical in H-JEB
The correlation both in vivo and in vitro of the dermo-epidermal separation
in H-JEB, with deficient immunoreactivity of anti-nicein/kalinin/laminin 5
antibodies, and the separation induced by anti-nicein/kalinin/laminin 5
antibodies have made the genes encoding this protein strong candidates for
the site of H-JEB mutations. In this example, it is demonstrated that the
molecular defect which causes H-JEB is linked to the gene encoding nicein/kalinin/laminin
5 γ-2 chain. In particular, the occurence of a homozygous premature
termination codon mutation is the specific cause in an examined case of H-JEB
(Aberdam et al., Nature Genetics, 1994, 6:299-304).
Expression of mRNA encoding the three nicein subunits by northern analysis
of RNA isolated from primary keratinocyte culture of a H-JEB patient was
determined as the initial screen. Hybridization with probes for the α-3 and
β-3 subunits was normal, but no hybridization with a cDNA encoding the γ-2
subunit was detected. Examination of the genomic DNA for gross
abnormalities, such as large deletions, insertions or rearrangements, in
LAMC2 (the γ-2 subunit gene) by Southern blot analysis turned up no
abnormalities when the genomic DNA was digested with BamHI, BglI, HindIII,
PstI or PvuII and probed with full length LAMC2 cDNA.
Possible mutations in the γ-2 subunit were sought by using cDNA reverse
transcribed from total RNA purified from cultured keratinocytes of the H-JEB
patient, and subjected to PCR amplification. The size of the amplified
products was checked by electrophoresis on 2% agarose gels and compared with
that obtained from healthy controls.
No major differences were detected in the agarose gels, and the PCR products
were examined by heteroduplex analysis (MDE). Heteroduplex analysis of the
most 5′ PCR product (nt 35-726) revealed the presence of a homoduplex in the
proband (pateint) and the controls. However, when the amplified PCR products
from the patient and control were mixed together, an additional band with
altered mobility, representing heteroduplexes, was detected, suggesting a
homozygous mutation in the patient's LAMC2 cDNA. This amplified fragment
corresponded to domain V of the γ-2 protein (Vailly et al., Eur. J. Biochem.,
1994, 219:209-218). Sequencing detected a C to T transition at position
+283, leading to a nonsense mutation in which a termination codon TGA
replaces an arginine (CGA), perhaps arising as a result of the
hypermutability of 5-methyl-cytosine to thymine at CpG nucleotides. This
mutation, R95X, leads to truncation of the γ-2 subunit polypeptide at amino
acid 95 and loss of a TaqI restriction site (TCGA). Digestion of cDNA with
TaqI confirmed the presence of a homozygous mutation in the DNA of the H-JEB
patient. No other mutations were detected.
To confirm the cosegregation of the mutation with the loss of the TaqI
restriction site, eight genotyped individuals of the family of the patient
were screened. In each case, a 120 base pair fragment was amplified by PCR
using genomic DNA templates and primers flanking the restriction site. Upon
digestion of the wild type amplification product, two clevage fragments of
80 and 40 base pairs are generated. Consistent with the presence of a
heterozygous mutation in carriers of this genotype, DNA fragments of 120, 80
and 40 base pairs, indicative of a wild type genotype, were found in the
paternal grandmother and two other relatives.
Cell Culture
Epidermis was separated from dermis by dispase treatment at 37 C.
Keratinocytes were dissociated in 0.25% trypsin at 37° C. and plated onto a
feeder layer of irradiated mouse 3T3 cells (ICN) (Rheinwald & Green, Cell,
175, 6:331-334). Keratinocytes were grown in a 1:1 mixture of DMEM and Ham's
F12 (BRL) containing 10% Fetal Calf Serum (FCS), 1 mM sodium pyruvate, 2 mM
L-glutamine, 10 μg/mL of penicillin and strptomycin, 10 ng/mL transferrin,
180 μM adenine and 20 pM T3 (Simon & Green, Cell, 1985, 40:677-683). H-JEB
keratinocytes were expanded after gentle dissociation in 0.05% trypsin,
0.02% EDTA.
Northern Blot Analysis
Total RNA was prepared from H-JEB and normal cultured keratinocytes
according to standard methods (Chomzynski & Sacchi, Anal. Biochem., 1987,
162: 156-159). RNA was electrophoresed in 1.2% denaturing agarose gels
containing 1.2M formaldehyde and transferred onto Hybond N membrane (Amersham).
Membranes were hybridized at high stringency with P-32 labeled cDNA probes
corresponding to the different chains of nicein, and then exposed on
Hyperfilm MP (Amersham) with intensifying screens. Radiolabeled cDNA probes
NA1 (Baudoin et al., J. Invest. Dermatol., 1994, in press), KAL-5.5C (Gerecke
et al., Eur. J. Biochem., 1994, in press), and PCR 1.3 (Vailly et al., 1994,
supra.), were used to detect the mRNAs for nicein chains α-3, β-3 and γ-2,
respectively.
RT-PCR and Heteroduplex Analysis (MDE)
50 μg of total RNA isolated from cultured keratinocytes from JEB patient,
and unrelated healthy controls were reverse transcribed in a volume of 100
μL as recommended by the manufacturer (BRL). 1 μL of the reaction product
was used to amplify overlapping regions of the cDNA that spanned the open
reading frame. Primer pair used to identify the mutation R95X: (L)
5′-GAGCGCAGAGTGAGAACCAC-3′ SEQ ID NO:16, (R) 5′-ACTGTATTCTGCAGAGCTGC-3′ SEQ
ID NO:17. PCR cycling conditions were: 94° C., 5 min, followed by 94° C., 45
sec; 60° C., 45 sec; 72° C., 45 sec; for 35 cycles, and extension at 72° C.
for 5 min. 5 μL aliquots were run in 2% agarose gels. Heteroduplex analysis
was performed as recommended by the manufacturer (MDE, AT Biochemicals).
Heteroduplexes were visualized under WV light in the presence of ethidium
bromide and photographed. Amplified cDNA fragments with altered mobility
were subcloned into the TA vector according to the manufacturer's
recommendations (Invitrogen). Sequence analysis were then performed using
standard techniques.
Verification of the Mutation
PCR reactions on genomic DNA (50 μg) were carried out using the upstream
primer 5′-TTCCTTTCCCCTACCTTGTG-3′ (SEQ ID NO:18) and the downstream printer
5′-TGTGGAAGCCTGGCAGACAT-3′ (SEQ ID NO: 19), which are located in the intron
2 and exon 3 of LAMC2 respectively. PCR conditions were: 95° C., 5 min,
followed by 94° C., 45 sec; 56° C., 45 sec; 72° C., 45 sec; for 35 cycles,
and extentions at 72° C. for 5 min. PCR products were used for restriction
analysis. 20 μL of PCR product obtained from genomic DNA was digested with
TaqI for 2 hours (Boehringer Mannheim). Cleavage products were
electrophoresed (2.4% agarose) stained and visualized under UV light.
Thus the methods allow for the screening of patients for mutations in the
γ-2 chain which correlate with H-JEB. As demonstrated, the results have
identified a nonsense mutation resulting in a truncated γ-2 chain, leading
to severe H-JEB. This was further confirmed by specific amplification and
restriction enzyme analysis of both the patient and relatives. Thus
demonstrating the effective screening for, and identification of, γ-2 chain
mutations which correlate with H-JEB. The methods are thus useful for
diagnosis, prenatal screening, early screening and detection, as well as
detailed examination of H-JEB. Furthermore, the results demonstrate the
significance of the γ-2 chain in forming proper cellular contacts.
Claim 1 of 6 Claims
1. A method for decreasing cell migration, comprising contacting
epithelial-derived cells with antibodies against γ2 chain domain III of
laminin 5, wherein the contacting results in decreased migration of the
epithelial-derived cells.
____________________________________________
If you want to learn more
about this patent, please go directly to the U.S.
Patent and Trademark Office Web site to access the full
patent.
|