Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 

Link:  Pharm/Biotech Resources


Title:  Laminin chains: diagnostic uses

United States Patent:  6,955,924

Issued:  October 18, 2005

Inventors:  Tryggvason; Karl (Oulu, FI); Kallunki; Pekka (La Jolla, CA); Pyke; Charles (Hilleroo, DK)

Assignee:  BioStratum, Inc. (Durham, NC)

Appl. No.:  756071

Filed:  January 8, 2001

Abstract

The instant invention provides for the identification, diagnosis, monitoring, and treatment of invasive cells using the laminin 5 gamma-2 chain protein or nucleic acid sequence, or antibodies thereto.

SUMMARY OF THE INVENTION

The instant invention provides for methods of detecting kalinin/laminin 5 expression in tissue comprising detecting a signal from assayed tissue, such signal resulting from specifically hybridizing tissue with an effective amount of a nucleic acid probe, which probe contains a sense or antisense portion of kalinin/laminin 5 gamma-2 nucleic acid sequence (Kallunki et al., 1992, supra.). In particular, where the nucleic acid probe is DNA, RNA, radio-labeled, enzyme labeled, chemiluminescent labeled, avidin or biotin labeled, derived from human kalinin/laminin 5 gamma-2 nucleic acid sequence, incorporated into an extrachromasomal self-replicating vector, a viral vector, is linear, circularized, or contains modified nucleotides. In the preferred embodiment the probes are linearized specific regions of the γ-2 gene.

The instant invention also provides for methods for detecting the presence of invasive cells in tissue comprising detecting a signal from assayed tissue, such signal resulting from contacting tissue with an effective amount of a nucleic acid probe, which probe contains a sense or antisense portion of kalinin/laminin 5 γ-2 nucleic acid sequence (Kallunki et al., 1992, supra.). In particular, where the nucleic acid probe is DNA, RNA, radio-labeled, enzyme labeled, chemiluminescent labeled, avidin or biotin labeled, derived from human kalinin/laminin 5 gamma-2 nucleic acid sequence, incorporated into an extrachromasomal self-replicating vector, a viral vector, is linear, circularized, or contains modified nucleotides. In the preferred embodiment the probes are linearized specific regions of the γ-2 gene. The instant method also provides for the diagnosis of the absence of γ-2 chain expression, useful for the monitoring of therapies, and the progress of malignant cell transformation leading to accurate determination of the extent of invasive cell activity.

The instant invention further provides for a method for detecting kalinin/laminin 5 expression in tissue comprising detecting a signal from assayed tissue, such signal resulting from contacting tissue with an effective amount of a labeled probe, which probe contains an antibody immunoreactive with a portion of kalinin/laminin 5 gamma-2 protein.

Further provided is a method for detecting invasive cells in tissue comprising detecting a signal from assayed tissue, such signal resulting from contacting tissue with an effective amount of a labeled probe, which probe contains an antibody immunoreactive with a portion of kalinin/laminin 5 gamma-2 protein. Also provided is a method for detecting kalinin/laminin 5 in tissue comprising detecting a signal from assayed tissue, such signal resulting from contacting tissue with an effective amount of a labeled probe, which probe contains an antibody immunoreactive with a potion of kalinin/laminin 5 gamma-2 protein. Thus the method of the instant invention provides for the absence of such signal as diagnostic for the absence of invasive cells.

Further, the present invention provides for a method of using the laminin-5 molecule to promote adhesion of cultured epithelial and carcinoma cells.

Additionally, the present invention is directed to a method for blocking migration of cells using antibodies against the γ-2 chain of the laminin-5 molecule. Evidence for the relationship of γ2 chain expression with cell migration was obtained by the identification of an enhancer element in the LAMC2 gene in studies on promoter-reporter gene constructs in transgenic mice.

DETAILED DESCRIPTION OF THE INVENTION

Epidermolysis bullosa (EB) is a group of mechano-bullous disorders characterized by fragility of the skin and mucous membranes (see Lin & Carter eds., Epidermolysis bullosa. Basic and clinical aspects, 1992, Springer Verlag, N.Y.; Fine et al., J. Am. Acad. Dermatol., 1991, 24:119-135). The junctional forms of EB (JEB) are characterized by tissue separation at the level of the lamina lucida within the dermal-epidermal basement membrane, and no specific mutation had yet to be reported. Recently it has been proposed that the genes for a lamina lucida protein kalinin/nicein/epiligin may be a candidate in some forms of JEB (Verrando et al., 1991, supra.). Several lines of evidence suggest that anchoring filament proteins could be defective in some forms of JEB. First, attenuation or absence of immunoreactivity with anti-kalinin(epiligrin) antibodies has been noted in the skin of patients with the most severe (Herlitz) type of JEB. The immunofluorescence staining patterns may be of prognostic value in classifying JEB, and these immunoreagents have been used for prenatal diagnosis of JEB using fetal skin biopsy specimens. Second, the kalinin/laminin 5 γ-2 chain is expressed in epithelial cells of the skin, trachea and kidneys, tissues which are frequently affected by JEB.

Since the majority of cases are of the generalized (Herlitz) phenotype (H-JEB), JEB patients have been classified into Herlitz and non-Herlitz types. Clinical features of H-JEB include mechanical fragility of the skin, with widespread blistering and erosions, rapid deterioration and neonatal death, often from sepsis. Longterm survival is rare.

Efforts to identify the basic defect in JEB began with the observation that a monoclonal antibody that binds to the lamina lucida of the epidermal basement membrane zone of normal skin, fails to react with the lamina lucida of H-JEB skin (Verrando et al., 1991, supra.). The antigen recognized by this antibody was purified from keratinocyte culture medium and termed BM600/nicein. Keratinocytes cultured from the skin of H-JEB patients attach poorly to substrate and fail to accumulate immunologically detectable nicein. Further experiments with antibodies specific for the α3 chain of nicein, demonstrated that they were capable of inducing the rounding and detachment of adherent keratinocytes without affecting fibroblasts (Rousselle et al., 1991, supra.). Thus the correlation in vivo and in vitro of the dermoepidermal separation with deficient nicein/kalinin/laminin 5 immunoreactivity and the separation induced by anti-nicein antibody have made the genes encoding this protein strong candidates for the site of H-JEB mutations.

The importance of the γ-2 chain of nicein/kalinin/laminin 5 in JEB, and epithelial tissues prompted the investigation into the role such adhesion contacts between epithelial cells may play in abberant cells. Of primary interest was the role γ-2 chain of nicein/kalinin/laminin 5 abberant expression may play in cancer tissue, and a possible role in cancer dissemination.

It has been recently shown that in colon adenocarcinoma, a significant positive correlation between the degree of tumor budding and the recurrence of tumors following curative surgery exists, and that this fact is likely to reflect a higher invasive potential of budding cancer cells as compared with cancer cells located deeper in the tumor (Hase et al., Dis. Colon Rectum, 1993, 36:627-635). Therefore, as demonstrated in Example 3 below, the instant invention allows for the useful prognostic determination of success of surgery, means for monitoring progression of rumor budding and subsequent prognosis.

The identification of the role of γ-2 chain allows for the novel use of kalinin/laminin 5 γ-2 chain and its ligand, as diagnostic probes of the tumor cell/basement membrane adhesion interface that is crucial for the invasion of non-malignant tissues, and identifies invasive cells.

Thus the identification of the role of γ-2 chain allows for the novel therapeutic intervention of binding of kalinin/laminin 5 to its ligand, and thereby reducing the tumor cell/basement membrane adhesion that is crucial for the invasion of non-malignant tissues, and method for inhibiting the budding of tumor masses, and a means for determing the level of γ-2 chain expression as a measure of budding activity of a given tumor.

As demonstrated in Example 3 below, the γ-2 chain of kalinin/laminin 5 is preferentially expressed by invasively growing malignant cells in human carcinomas. Furthermore, migrating keratinocytes in wound healing also expressed this gene, pointing to a role of γ-2 chain in epithelial cell migration both in malignant and in nonmalignant pathological conditions. The consistent expression of the γ-2 chain gene in invading cancer cells reflects a functional importance of this molecule in vivo in establishing contacts between the invading malignant cells and a provisional matrix in the immediate surroundings of the cancer cells. The instant invention provides methods for the identification of, and diagnosis of invasive cells and tissues, and for the monitoring of the progress of therapeutic treatments.

In a preferred embodiment of this aspect of the instant invention the nucleic acid probe comprise a specifically hybridizing fragment of the γ-2 chain cDNA nucleic acid sequence. In this embodiment, the nucleic acid sequence comprises all or a specifically hybridizing fragment of an open reading frame of the nucleic acid sequence for the γ-2 chain (FIG. 4) encoding the amino acid sequence of the γ-2 chain (FIG. 4). It will be understood that the term "specifically hybridizing" when used to describe a fragment of nueleic acid encoding a human laminin γ-2 chain gene is intended to mean that, nueleic acid hybridization of such a fragment is stable under high stringency conditions of hybridization and washing as the term "high stringency" would be understood by those having skill in the molecular biological arts.

Further, the instant invention provides for the therapeutic treatment of such invasive tissues by using γ-2 chain or biologically active fragments thereof to interfere with the interactions between abberant γ-2 chain and surrounding tissues. The instant invention also provides for the intervention of γ-2 chain interaction with surrounding tissues by using specific anti-γ-2 chain antibodies (monoclonal or polyclonal) to inhibit the γ-2 chain biological activity.

The instant disclosure also allows one to ablate the invasive cell phenotypic γ-2 chain expression by using genetic manipulation to "knock-out" the functional expression of the γ-2 chain gene in cancer cells, or to completely "knock-out" the functional γ-2 chain gene in the genome of cancer cells. Such knock-outs can be accomplished by using genetic molecular biological techniques for inserting by homologous recombination into genomic DNA, targeted transposon insertion, or random insertion/deletion mutations in the genomic DNA.

The instant disclosure also allows for the therapeutic treatment of invasive cell phenotype by the inhibition of functional γ-2 chain expression in targeted cells by using anti-sense technology, such methods for anti-sense production, stabilization, delivery, and therapeutic approaches are reviewed in Uhlmann et al., 1990, Chem. Reviews 90:543-584).

Moreover, the present invention is also directed to two important functional aspects of the epithelium specific laminin-5, i.e. cell adhesion and migration. First of all, according to the present invention, the γ2 subunit chain, as such, does not promote cell adhesion and, secondly, the laminin-5 isoform and its γ2 chain subunit play a role in the migratory process of cells of epithelial origin. According to the present invention, the migratory function of the γ2 chain is a characteristic for domain III, as shown with antibody inhibition studies. Furthermore, involvement of the γ2 chain in cell migration was shown to be related with a cis-acting element in LAMC2 gene, as studied in transgenic mice using promoter-reporter gene constructs.

Thus the instant invention provides for a method of detection, diagnosis, prognosis, monitoring, and therapeutic treatment of invasive cell phenotypes.

The examples below are meant by way of illustration, and are not meant to be limiting as to the scope of the instant disclosure.

EXAMPLE 1

Mutation in the γ2 Chain Gene LAMC2 is Critical in Some Cases of JEB

A unique scanning strategy using RT-PCR amplification of LAMC2 sequences was devised to detect truncated forms of γ-2 chain gene transcripts (Pulkkinen et al., Nature Genetics, 1994, 6:293-298). The 3.6 kilobase coding sequence of the LAMC2 mRNA, was reverse transcribed and amplified with eight pairs of primers, producing overlapping PCR amplimers designated A-H. The PCR products were then examined by agarose gel electrophoresis, followed by MDE heteroduplex analysis. If bands with altered mobility were detected, the PCR products were sequenced, and compared with normal sequences from unaffected family members or unrelated individuals. Intron/exon borders were identified by PCR analysis of genomic DNA, deduced by comparison with cDNA sequences.

A Point Mutation Produces Exon Skipping

When a panel of five unrelated JEB patients were analysed, the primers used to amplify segment C (nt 1046-1537) produced a markedly shortened band of 273 base pairs, as compared with the normal 491 base pairs. No evidence of the normal sized band was noted, suggesting that the patient was homozygous for this allele. Direct sequencing revealed that the shortened product resulted from the deletion of 219 base pairs corresponding to nucleotides 1184-1402 in the cDNA, thus exon 9 was deleted. The remaining nucleotide sequences within this and other PCR products did not reveal any additional mutations upon MDE analysis.

Subsequent examination of the genomic DNA revealed that the sequences for exons 8, 9 and 10 were present, however a homozygous G for A substitution at the 3′ acceptor splice site at the junction of intron 8 and exon 9, abolished the obligatory splice site sequence (AG).

Examination of another patient revealed that PCR product F (nt 2248-2777) corresponding to domains I and II of the γ-2 chain, was a band with altered mobility. Sequencing the abnormal product revealed a 20 bp deletion, followed by a single base pair (G) insertion in the coding region corresponding to exon 16. This mutation causes a frameshift which results in a premature stop codon 51 base pairs downstream from the deletion-insertion, producing a truncated kalinin/laminin 5 γ-2 chain terminating at residue 830.

RT-PCR and MDE Analyses

RNA isolated from fibroblast cell cultures of JEB patients was used as template for RT-PCR of the LAMC2 mRNA. (Epidermal keratinocytes can also be used). cDNA was prepared from 50 μg of total RNA in a volume of 100 μL according to manufacturer's reccomendations (BRL), and oligonucleotide primers were synthesized on the basis of the cDNA sequence (FIG. 4; Kallunki et al., 1992, supra.), to generate about 500 base pair products, which spanned the entire coding region.

For PCR amplification, 1 μL of cDNA was used as template and amplification conditions were 94° C. for 5 min followed by 95° C. for 45 sec, 60° C. for 45 sec and 72° C. for 45 sec for 35 cycles in an OmniGene thermal cycler (Marsh Scientific). Amplification was performed in a total volume of 25 μL containing 1.5 mM MgCl.sub.2, and 2 U Taq polymerase (Boehringer Mannheim). Aliquots of 5 μL were analysed on 2% agarose gels and MDE heteroduplex analysis was performed according to the manufacturer's reccomendation (AT Biochemicals). Heteroduplexes were visualized by staining with ethidium bromide. If a band of altered mobility was detected in heteroduplex analysis, the PCR product was subcloned into the TA vector (Invitrogen), and sequenced by standard techniques.

DNA isolated either from fibroblast cultures or from specimens obtained from buccal smears, was used as template for amplification of genomic sequences. For amplification of introns 8 and 16, .about.500 ng of genomic DNA was used as template and the following oligomer primers were utilized.
 

5′GGCTCACCAAGACTTACACA 3′ (SEQ ID NO:1);
5′GAATCACTGAGCAGCTGAAC 3′ (SEQ ID NO:2);
5′CAGTACCAGAACCGAGTTCG 3′ (SEQ ID NO:3);
5′CTGGTTACCAGGCTTGAGAG 3′ (SEQ ID NO:4);
5′TTACTGCGGAATCTCACAGC 3′ (SEQ ID NO:5);
5′TACACTGTTCAACCCAGGGT 3′ (SEQ ID NO:6);
5′AAACAAGCCCTCTCACTGGT 3′ (SEQ ID NO:7);
5′GCGGAGACTGTGCTGATAAG 3′ (SEQ ID NO:8);
5′CATACCTCTCTACATGGCAT 3′ (SEQ ID NO:9);
5′AGTCTCGCTGAATCTCTCTT 3′ (SEQ ID NO:10);
5′TTACAACTAGCATGGTGCCC 3′ (SEQ ID NO:11);


Amplification conditions were 94° C. for 7 min followed by 95° C. for 1.5 min, 56° C. (intron 8) or 58° C. (intron 16) for 1 min and 72° C. for 1.5 min for 35 cycles in an OmniGene thermal cycler (Marsh Scientific). Amplification was performed in a total volume of 25 μL containing 1.5 mM MgCl.sub.2, and 2 U Taq polymerase (Boehringer Mannheim). The PCR products were subcloned and sequenced as above.
Verification of Mutations

The putative mutations detected in the PCR products were verified at the genomic level in both cases. For this purpose, a search for a potential change in restriction endonuclease sites as a result of the mutation was performed.

Amplification conditions were 94° C. for 7 min followed by 94° C. for 1 min, 58° C. for 45 sec and 72° C. for 45 sec for 35 cycles in an OmniGene thermal cycler (Marsh Scientific). PCR products were analysed on 2.5% agarose gels.

The methods described allow for the screening of patients for mutations in the γ-2 chain which will correlate with JEB. As demonstrated, the results have identified a homozygous point mutation resulting in oxon skipping, and a heterozygous deletion-insertion mutation. This demonstrating the effective screening for, and identification of, γ2 chain mutations which correlate with JEB. The methods are thus useful for diagnosis, prenatal screening, early screening and detection, as well as detailed examination of JEB. Further, the results show that the functional role of γ-2 chain expression in epithelial cells is important in determining proper intercellular connectivity, relating to the integrity of tissues and cell interactions.

EXAMPLE 2

Mutation in the γ-2 Chain Gene LAMC2 is Critical in H-JEB

The correlation both in vivo and in vitro of the dermo-epidermal separation in H-JEB, with deficient immunoreactivity of anti-nicein/kalinin/laminin 5 antibodies, and the separation induced by anti-nicein/kalinin/laminin 5 antibodies have made the genes encoding this protein strong candidates for the site of H-JEB mutations. In this example, it is demonstrated that the molecular defect which causes H-JEB is linked to the gene encoding nicein/kalinin/laminin 5 γ-2 chain. In particular, the occurence of a homozygous premature termination codon mutation is the specific cause in an examined case of H-JEB (Aberdam et al., Nature Genetics, 1994, 6:299-304).

Expression of mRNA encoding the three nicein subunits by northern analysis of RNA isolated from primary keratinocyte culture of a H-JEB patient was determined as the initial screen. Hybridization with probes for the α-3 and β-3 subunits was normal, but no hybridization with a cDNA encoding the γ-2 subunit was detected. Examination of the genomic DNA for gross abnormalities, such as large deletions, insertions or rearrangements, in LAMC2 (the γ-2 subunit gene) by Southern blot analysis turned up no abnormalities when the genomic DNA was digested with BamHI, BglI, HindIII, PstI or PvuII and probed with full length LAMC2 cDNA.

Possible mutations in the γ-2 subunit were sought by using cDNA reverse transcribed from total RNA purified from cultured keratinocytes of the H-JEB patient, and subjected to PCR amplification. The size of the amplified products was checked by electrophoresis on 2% agarose gels and compared with that obtained from healthy controls.

No major differences were detected in the agarose gels, and the PCR products were examined by heteroduplex analysis (MDE). Heteroduplex analysis of the most 5′ PCR product (nt 35-726) revealed the presence of a homoduplex in the proband (pateint) and the controls. However, when the amplified PCR products from the patient and control were mixed together, an additional band with altered mobility, representing heteroduplexes, was detected, suggesting a homozygous mutation in the patient's LAMC2 cDNA. This amplified fragment corresponded to domain V of the γ-2 protein (Vailly et al., Eur. J. Biochem., 1994, 219:209-218). Sequencing detected a C to T transition at position +283, leading to a nonsense mutation in which a termination codon TGA replaces an arginine (CGA), perhaps arising as a result of the hypermutability of 5-methyl-cytosine to thymine at CpG nucleotides. This mutation, R95X, leads to truncation of the γ-2 subunit polypeptide at amino acid 95 and loss of a TaqI restriction site (TCGA). Digestion of cDNA with TaqI confirmed the presence of a homozygous mutation in the DNA of the H-JEB patient. No other mutations were detected.

To confirm the cosegregation of the mutation with the loss of the TaqI restriction site, eight genotyped individuals of the family of the patient were screened. In each case, a 120 base pair fragment was amplified by PCR using genomic DNA templates and primers flanking the restriction site. Upon digestion of the wild type amplification product, two clevage fragments of 80 and 40 base pairs are generated. Consistent with the presence of a heterozygous mutation in carriers of this genotype, DNA fragments of 120, 80 and 40 base pairs, indicative of a wild type genotype, were found in the paternal grandmother and two other relatives.

Cell Culture

Epidermis was separated from dermis by dispase treatment at 37 C. Keratinocytes were dissociated in 0.25% trypsin at 37° C. and plated onto a feeder layer of irradiated mouse 3T3 cells (ICN) (Rheinwald & Green, Cell, 175, 6:331-334). Keratinocytes were grown in a 1:1 mixture of DMEM and Ham's F12 (BRL) containing 10% Fetal Calf Serum (FCS), 1 mM sodium pyruvate, 2 mM L-glutamine, 10 μg/mL of penicillin and strptomycin, 10 ng/mL transferrin, 180 μM adenine and 20 pM T3 (Simon & Green, Cell, 1985, 40:677-683). H-JEB keratinocytes were expanded after gentle dissociation in 0.05% trypsin, 0.02% EDTA.

Northern Blot Analysis

Total RNA was prepared from H-JEB and normal cultured keratinocytes according to standard methods (Chomzynski & Sacchi, Anal. Biochem., 1987, 162: 156-159). RNA was electrophoresed in 1.2% denaturing agarose gels containing 1.2M formaldehyde and transferred onto Hybond N membrane (Amersham). Membranes were hybridized at high stringency with P-32 labeled cDNA probes corresponding to the different chains of nicein, and then exposed on Hyperfilm MP (Amersham) with intensifying screens. Radiolabeled cDNA probes NA1 (Baudoin et al., J. Invest. Dermatol., 1994, in press), KAL-5.5C (Gerecke et al., Eur. J. Biochem., 1994, in press), and PCR 1.3 (Vailly et al., 1994, supra.), were used to detect the mRNAs for nicein chains α-3, β-3 and γ-2, respectively.

RT-PCR and Heteroduplex Analysis (MDE)

50 μg of total RNA isolated from cultured keratinocytes from JEB patient, and unrelated healthy controls were reverse transcribed in a volume of 100 μL as recommended by the manufacturer (BRL). 1 μL of the reaction product was used to amplify overlapping regions of the cDNA that spanned the open reading frame. Primer pair used to identify the mutation R95X: (L) 5′-GAGCGCAGAGTGAGAACCAC-3′ SEQ ID NO:16, (R) 5′-ACTGTATTCTGCAGAGCTGC-3′ SEQ ID NO:17. PCR cycling conditions were: 94° C., 5 min, followed by 94° C., 45 sec; 60° C., 45 sec; 72° C., 45 sec; for 35 cycles, and extension at 72° C. for 5 min. 5 μL aliquots were run in 2% agarose gels. Heteroduplex analysis was performed as recommended by the manufacturer (MDE, AT Biochemicals). Heteroduplexes were visualized under WV light in the presence of ethidium bromide and photographed. Amplified cDNA fragments with altered mobility were subcloned into the TA vector according to the manufacturer's recommendations (Invitrogen). Sequence analysis were then performed using standard techniques.

Verification of the Mutation

PCR reactions on genomic DNA (50 μg) were carried out using the upstream primer 5′-TTCCTTTCCCCTACCTTGTG-3′ (SEQ ID NO:18) and the downstream printer 5′-TGTGGAAGCCTGGCAGACAT-3′ (SEQ ID NO: 19), which are located in the intron 2 and exon 3 of LAMC2 respectively. PCR conditions were: 95° C., 5 min, followed by 94° C., 45 sec; 56° C., 45 sec; 72° C., 45 sec; for 35 cycles, and extentions at 72° C. for 5 min. PCR products were used for restriction analysis. 20 μL of PCR product obtained from genomic DNA was digested with TaqI for 2 hours (Boehringer Mannheim). Cleavage products were electrophoresed (2.4% agarose) stained and visualized under UV light.

Thus the methods allow for the screening of patients for mutations in the γ-2 chain which correlate with H-JEB. As demonstrated, the results have identified a nonsense mutation resulting in a truncated γ-2 chain, leading to severe H-JEB. This was further confirmed by specific amplification and restriction enzyme analysis of both the patient and relatives. Thus demonstrating the effective screening for, and identification of, γ-2 chain mutations which correlate with H-JEB. The methods are thus useful for diagnosis, prenatal screening, early screening and detection, as well as detailed examination of H-JEB. Furthermore, the results demonstrate the significance of the γ-2 chain in forming proper cellular contacts.

 

Claim 1 of 6 Claims

1. A method for decreasing cell migration, comprising contacting epithelial-derived cells with antibodies against γ2 chain domain III of laminin 5, wherein the contacting results in decreased migration of the epithelial-derived cells.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]