|
|

Link:
Pharm/Biotech Resources
Title: Methods of assessing HIV integrase inhibitor
therapy
United States Patent: 6,958,211
Issued: October 25, 2005
Inventors: Vingerhoets; Johan Hendrika Jozef (Wijnegem, BE);
Michiels; Lieve Emma Jan (Mol, BE); Dierynck; Inge (Antwerp, BE)
Assignee: Tibotech BVBA (Mechelen, BE)
Appl. No.: 215158
Filed: August 8, 2002
Abstract
Methods and products for the evaluation of HIV treatment are provided.
The methods are based on evaluating molecular events at the HIV integrase
resulting in altered therapeutic efficacy of tho investigated compounds. The
methods rely on providing an integrase gene and evaluating either through
integrase gene genotyping or phenotyping.
DETAILED DESCRIPTION OF THE INVENTION
The instant invention provides techniques for evaluating human
immunodeficiency (HIV) drug effectiveness. Assays for wild type or mutant
HIV integrase are provided, using a set of primers designed for the
amplification and analysis of HIV genetic material. The assessment of
patient borne viral integrase leads to a better prediction of the drugs
suitable for treatment of the strains present in the infected individual.
The protocols and products may be used for diverse diagnostic, clinical,
toxicological, research and forensic purposes including, drug discovery,
designing patient therapy, drug efficacy testing and patient management. The
assays described herein may be used in combination with other assays. The
results may be implemented in computer models and databases. The products
described herein may be incorporated into kits.
The instant invention relates to a method for determining the susceptibility
of at least one HIV virus to at least one treatment, comprising: i)
obtaining at least one sample of HIV RNA, wherein the sample comprises at
least one IN gene or a portion thereof; ii) reverse-transcribing and
amplifying the HIV RNA with primers specific for IN region of the HIV genome
to obtain at least one DNA construct comprising the at least one IN gene or
a portion thereof; iii) preparing at least one recombinant virus by
homologous recombination or ligation between the amplified at least one DNA
construct and a plasmid comprising the wild-type HIV sequence with a
deletion in the IN region of the HIV genome, and iv) determining the
phenotypic susceptibility of at least one HIV virus to at least one
treatment by monitoring the at least one recombinant virus in the presence
of the at least one treatment.
In particular, the present invention relates to a method for determining the
susceptibility of at least one HIV virus to at least one drug, comprising: i)
obtaining at least one sample comprising HIV RNA, wherein the sample
comprises at least one IN gene or a portion thereof; ii) reverse
transcribing and amplifying the HIV RNA with primers specific for IN region
of the HIV genome to obtain at least one amplicon comprising the at least
one IN gene or a portion thereof; iii) using nucleic acid amplification to
generate a plasmid comprising the wild-type HIV sequence with a deletion in
the IN region of the HIV genome; iv) preparing at least one recombinant
virus by homologous recombination or ligation between the amplified at least
one amplicon and a plasmid comprising the wild-type HIV sequence with a
deletion in the IN region, and v) monitoring the at least one recombinant
virus in the presence of the at least one treatment to determine the
phenotypic susceptibility of at least one HIV virus to said at least one
drug.
Reverse transcription and amplification may be performed with a single set
of primers. Alternatively, more than one set of primers may be used in a
hemi-nested approach to reverse transcribe and amplify the genetic material.
Particularly, more than one set of primer is used in a nested approach.
Following the generation of the recombinant construct, the chimeric virus
may be grown and the viral titer determined (expressed as multiplicity of
infection, MOI) before proceeding to the determination of the phenotypic
susceptibility. The indicator gene, encoding a signal indicative of
replication of the virus in the presence of a drug or indicative of the
susceptibility of the virus in the presence of a drug may be present in the
culturing cells such as MT-4 cells. In addition, said indicator gene may be
incorporated in the chimeric construct introduced into the culturing cells
or may be introduced separately. Suitable indicator genes encode fluorescent
proteins, particularly green fluorescent protein or mutants thereof. In
order to allow homologous recombination, genetic material may be introduced
into the cells using a variety of techniques known in the art including,
calcium phosphate precipitation, liposomes, viral infection, and
electroporation. The monitoring may be performed in high throughput.
A human immunodeficiency virus (HIV), as used herein refers to any HIV
including laboratory HIV strains, wild type HIV strains, mutant HIV strains
and any biological sample comprising at least one HIV virus, such as, for
example, an HIV clinical isolate. HIV strains compatible with the present
invention are any such strains that are capable of infecting mammals,
particularly humans. Examples are HIV-1 and HIV-2. For reduction to practice
of the present invention, an HIV virus refers to any sample comprising at
least one HIV virus. As for instance a patient may have HIV viruses in his
body with different mutations in the integrase (IN) gene. It is to be
understood that a sample may contain a variety of different HIV viruses
containing different mutational profiles in the IN gene. A sample may be
obtained for example from an individual, from cell cultures, or generated
using recombinant technology, or cloning. HIV strains compatible with the
present invention are any such strains that are capable of infecting
mammals, particularly humans. Viral strains used for obtaining a plasmid are
preferably HIV wild-type sequences, such as LAI or HXB2D. LAI, also known as
IIIB, is a wild type HIV strain. One particular clone thereof, this means
one sequence, is HXB2D. This sequence may be incorporated into a plasmid.
Instead of viral RNA, HIV DNA, e.g. proviral DNA, may be used for the
methods described herein. In case RNA is used, reverse transcription into
DNA by a suitable reverse transcriptase is needed. The protocols describing
the analysis of RNA are also amenable for DNA analysis. However, if a
protocol starts from DNA, the person skilled in the art will know that no
reverse transcription is needed. The primers designed to amplify the RNA
strand, also anneal to, and amplify DNA. Reverse transcription and
amplification may be performed with a single set of primers. Suitably a
hemi-nested and more suitably a nested approach may be used to reverse
transcribe and amplify the genetic material.
Thus, the phenotyping method of the present invention may also comprise: i)
obtaining at least one sample comprising HIV DNA, wherein the sample
comprises at least one IN gene or a portion thereof; ii) amplifying the HIV
DNA with primers specific for IN region of the HIV genome to obtain at least
one amplicon comprising the at least one IN gene or a portion thereof; iii)
generating a plasmid comprising the wild-type HIV sequence with a deletion
in the IN region of the HIV genome characterized in that said deletion is
generated using nucleic acid amplification; iv) preparing at least one
recombinant virus by homologous recombination or ligation between the
amplified at least one amplicon and a plasmid comprising the wild-type HIV
sequence with a deletion in the IN region, and v) monitoring the at least
one recombinant virus in the presence of the at least one drug to determine
the phenotypic susceptibility of at least one HIV virus to at least one
drug.
Nucleic acid may be amplified by techniques such as polymerase chain
reaction (PCR), nucleic acid sequence based amplification (NASBA),
self-sustained sequence replication (3SR), transcription based amplification
(TAS), ligation chain reaction (LCR). Often PCR is used.
Any type of patient sample may be used to obtain the integrase gene, such
as, for example, serum and tissue. Viral RNA may be isolated using known
methods such as described in Boom, R. et al. (J. Clin. Microbiol. 28(3):
495-503 (1990)). Alternatively, a number of commercial methods such as the
QIAAMP® viral RNA kit (Qiagen, Inc.) may be used to obtain viral RNA from
bodily fluids such as plasma, serum, or cell-free fluids. DNA may be
obtained by procedures known in the art (e.g. Maniatis, 1989) and commercial
procedures (e.g. Qiagen).
The complete integrase (IN) or a portion of the IN gene may be used. The
complete IN gene comprises 864 nucleotides (nt), coding for a 288 amino acid
long integrase. A portion of the IN gene is defined as a fragment of IN gene
recovered from patient borne virus, lab viruses including IIIB and NL4-3, or
mutant viruses. This fragment does not encompass the complete 864 nt. Said
fragment may be obtained directly from its source, including a patient
sample, or may be obtained using molecular biology tools following the
recovery of the complete IN sequence. Amplicon refers to the amplified, and
where necessary, reverse transcribed integrase gene or portion thereof. It
should be understood that this IN may be of diverse origin including
plasmids and patient material. Suitably, the amplicon is obtained from
patient material. For the purpose of the present invention the amplicon is
sometimes referred to as "DNA construct". A viral sequence may contain one
or multiple mutations versus the consensus reference sequence given by
K03455. Said sequence, K03455, is present in Genbank and available through
the internet. A single mutation or a combination of IN mutations may
correlate to a change in drug efficacy. This correlation may be indicative
of an altered i.e. decreased or increased susceptibility of the virus for a
drug. Said mutations may also influence the viral fitness.
"Chimeric" means a construct comprising nucleic acid material from different
origin such as for example a combination of wild type HIV with a laboratory
HIV virus, a combination of wild type HIV sequence and patient derived HIV
sequence.
A "drug" means any agent such as a chemotherapeutic, peptide, antibody,
antisense, ribozyme and any combination thereof. Examples of drugs include
protease inhibitors including ritonavir, amprenavir, nelfinavir; reverse
transcriptase inhibitors such as nevirapine, delavirdine, AZT, zidovudine,
didanosine; integrase inhibitors; agents interfering with envelope (such as
for example T-20, T-1249). Treatment or treatment regimen refers to the
therapeutic management of an individual by the administration of drugs.
Different drug dosages, administration schemes, administration routes and
combinations may be used to treat an individual.
An alteration in viral drug sensitivity is defined as a change in
susceptibility of a viral strain to said drug. Susceptibilities are
generally expressed as ratios of EC50 or EC90 values
(the EC50 or EC90 value being the drug concentration
at which 50% or 90% respectively of the viral population is inhibited from
replicating) of a viral strain under investigation compared to the wild type
strain. Hence, the susceptibility of a viral strain towards a certain drug
can be expressed as a fold change in susceptibility, wherein the fold change
is derived from the ratio of for instance the EC50 values of a
mutant viral strain compared to the wild type EC50 values. In
particular, the susceptibility of a viral strain or population may also be
expressed as resistance of a viral strain, wherein the result is indicated
as a fold increase in EC50 as compared to wild type EC50.
The IC50 is the drug concentration at which 50% of the enzyme
activity is inhibited.
The susceptibility of at least one HIV virus to a drug may be tested by
determining the cytopathogenicity of the recombinant virus to cells. In the
context of this invention, the cytopathogenic effect means the viability of
the cells in culture in the presence of chimeric viruses. The cells may be
chosen from T cells, monocytes, macrophages, dendritic cells, Langerhans
cells, hematopoetic stem cells or precursor cells, MT4 cells and PM-1 cells.
Suitable host cells for homologous recombination of HIV sequences include
MT4 and PM-1. MT4 is a CD4+ T-cell line containing the CXCR4
co-receptor. The PM-1 cell line expresses both the CXCR4 and CCR5
co-receptors. All of the cells mentioned above are capable of producing new
infectious virus particles upon recombination of the IN deletion vectors
with IN sequences such as those derived from patient samples. Thus, they can
also be used for testing the cytopathogenic effects of recombinant viruses.
The cytopathogenicity may, for example, be monitored by the presence of any
reporter molecule including reporter genes. A reporter gene is defined as a
gene whose product has reporting capabilities. Suitable reporter molecules
include tetrazolium salts, green fluorescent proteins, beta-galactosidase,
chloramfenicol transferase, alkaline phophatase, and luciferase. Several
methods of cytopathogenic testing including phenotypic testing are described
in the literature comprising the recombinant virus assay (Kellam and Larder,
Antimicrob. Agents Chemotherap. 1994, 38, 23-30, Hertogs et al. Antimicrob.
Agents Chemotherap. 1998, 42, 269-276; Pauwels et al. J. Virol Methods 1988,
20, 309-321)
The susceptibility of at least one HIV virus to at least one drug may be
determined by the replicative capacity of the recombinant virus in the
presence of at least one drug, relative to the replicative capacity of an
HIV virus with a wild-type IN gene sequence. Replicative capacity means the
ability of the virus or chimeric construct to grow under culturing
conditions. This is sometimes referred to as viral fitness. The culturing
conditions may contain triggers that influence the growth of the virus,
examples of which are drugs. The methods for determining the susceptibility
may be useful for designing a treatment regimen for an HIV-infected patient.
For example, a method may comprise determining the replicative capacity of a
clinical isolate of a patient and using said replicative capacity to
determine an appropriate drug regime for the patient. One approach is the
Antivirogram® assay.
The IN phenotyping assays of the present invention can be performed at high
throughput using, for example, a microtiter plate containing a variety of
anti-HIV drugs. The present assays may be used to analyse the influence of
changes at the HIV IN gene to any type of drug useful to treat HIV. Examples
of anti-HIV drugs that can be tested in this assay include, nucleoside and
non-nucleoside reverse transcriptase inhibitors, nucleotide reverse
transcriptase inhibitors, protease inhibitors, membrane fusion inhibitors,
and integrase inhibitors, but those of skill in the art will appreciate that
other types of antiviral compounds may also be tested. The results may be is
monitored by several approaches including but not limited to morphology
screening, microscopy, and optical methods, such as, for example, absorbance
and fluorescence. An IC50 value for each drug may be obtained in
these assays and used to determine viral replicative capacity in the
presence of the drug. Apart from IC50 also e.g. IC90
or EC50 (effective concentrations) can be used. The replicative
capacity of the viruses may be compared to that of a wild-type HIV virus to
determine a relative replicative capacity value. Data from phenotypic assays
may further be used to predict the behaviour of a particular HIV isolate to
a given drug based on its genotype.
The assays of the present invention may be used for therapeutic drug
monitoring. Said approach includes a combination of susceptibility testing,
determination of drug level and assessment of a threshold. Said threshold
may be derived from population based pharmacokinetic modelling (WO
02/23186). The threshold is a drug concentration needed to obtain a
beneficial therapeutic effect in vivo. The in vivo drug level may be
determined using techniques such as high performance liquid chromatography,
liquid chromatography, mass spectroscopy or combinations thereof. The
susceptibility of the virus may be derived from phenotyping or
interpretation of genotyping results i.e. virtual phenotyping (WO 01/79540).
The assays of the present invention may be useful to discriminate an
effective drug from an ineffective drug by establishing cut-offs i.e.
biological cut-offs (see e.g. WO 02/33402). A biological cut-off is drug
specific. These cut-offs are determined following phenotyping a large
population of individuals containing wild type viruses. The cut-off is
derived from the distribution of the fold increase in resistance of the
virus for a particular drug.
The instant invention also relates to a kit for phenotyping HIV integrase.
Such kit, useful for determining the susceptibility of at least one HIV
virus to at least one drug, may comprise: i) at least one of the primers
selected from SEQ ID No1-16, and ii) a plasmid as described in
the present invention. For the purpose of performing the phenotyping assay,
such kit may be further completed with at least one inhibitor. Optionally, a
reference plasmid bearing a wild type HIV sequence may be added. Optionally,
cells susceptible of HIV transfection may be added to the kit. In addition,
at least one reagent for monitoring the indicator genes, or reporter
molecules such as enzyme substrates, may be added.
The present invention also describes a method for determining the
susceptibility of at least one HIV virus to at least one drug, comprising: i)
obtaining at least one sample comprising HIV RNA, wherein the sample
comprises at least one IN gene or a portion thereof; ii)
reverse-transcribing and amplifying said HIV RNA with primers specific for
the IN region of the HIV genome to obtain an amplicon comprising the IN gene
or a portion thereof; iii) determining the nucleotide sequence of the
amplicon or a portion thereof, and iv) comparing the nucleotide sequence of
the amplicon to the sequence of known sequences to determine the
susceptibility of at least one HIV virus to at least one drug. This assay
protocol is commonly referred to as genotyping.
The genotype of the patient-derived IN coding region may be determined
directly from the amplified DNA, i.e. the DNA construct, by performing DNA
sequencing during the amplification step. Alternatively, the sequence may be
obtained after sub-cloning into a suitable vector. A variety of commercial
sequencing enzymes and equipment may be used in this process. The efficiency
may be increased by determining the sequence of the IN coding region in
several parallel reactions, each with a different set of primers. Such a
process could be performed at high throughput on a multiple-well plate, for
example. Commercially available detection and analysis systems may be used
to determine and store the sequence information for later analysis. The
nucleotide sequence may be obtained using several approaches including
sequencing nucleic acids. This sequencing may be performed using techniques
including gel based approaches, mass spectroscopy and hybridisation.
However, as more resistance related mutations are identified, the sequence
at particular nucleic acids, codons or short sequences may be obtained. If a
particular resistance associated mutation is known, the nucleotide sequence
may be determined using hybridisation assays (including Biochips, LipA-assay),
mass spectroscopy, allele specific PCR, or using probes or primers
discriminating between mutant and wild-type sequence. For these purposes the
probes or primers may be suitably labelled for detection (e.g. Molecular
beacons, TaqMan®, SunRise primers). Suitably, fluorescent or quenched
fluorescent primers are used. The primer is present in a concentration
ranging from 0.01 pmol to 100 pmol, suitably between 0.10 and 10 pmol. The
cycling conditions include a denaturation step during 0.5 to 10 minutes,
suitably, 1 to 5 minutes at a temperature ranging from 85 to 99° C.
Interestingly, the temperature is between 90 and 98° C. Subsequently, the
material is cycled during 14 to 45 cycles, suitably between 20 to 40 cycles,
more suitably during 25 to 35 cycles. Nucleic acid is denatured at 90 to 98°
C. during 5 seconds to 2 minutes. Suitably, denaturation periods range from
15 seconds to 1 minute. Annealing is performed at 40 to 60° C.,
specifically, between 45° C. and 57° C. The annealing period is 5 seconds to
1 minute, especially between 10 seconds and 35 seconds. Elongation is
performed at 60° C. to 75° C. during 10 seconds to 10 minutes. Preferably,
the elongation period is 15 seconds to 5 minutes. A selected set of
sequencing primers includes SEQ ID 17-22. This particular selection has the
advantage that it enables the sequencing of the complete HIV integrase gene.
Consequently, using this set of primers all possible mutations that may
occur in the HIV integrase gene may be resolved.
The patient IN genotype provides an additional means to determine drug
susceptibility of a virus strain. Phenotyping is a lengthy process often
requiring 2 or more weeks to accomplish. Therefore, systems have been
developed which enable the prediction of the phenotype based on the
genotypic results. The results of genotyping may be interpreted in
conjunction with phenotyping and eventually be subjected to database
interrogation. A suitable system is virtual phenotyping (WO 01/79540). In
the virtual phenotyping process the complete IN genes may be used.
Alternatively, portions of the genes may be used. Also combinations of
mutations, preferentially mutations indicative of a change in drug
susceptibility, may be used. A combination of mutations is sometimes
referred to as a hot-spot (see e.g. WO 01/79540). Briefly, in the process of
virtual phenotyping, the genotype of a patient derived IN sequence may be
correlated to the phenotypic response of said patient derived IN sequence.
If no phenotyping is performed, the sequence may be screened towards a
collection of sequences present in a database. Identical sequences are
retrieved and the database is further interrogated to identify if a
corresponding phenotype is known for any of the retrieved sequences. In this
latter case a virtual phenotype may be determined. A report may be prepared
including the EC50 of the viral strain for one or more therapies,
the sequence of the strain under investigation, biological cut-offs.
The present invention also relates to a kit for genotyping HIV integrase.
Such kit useful for determining the susceptibility of at least one HIV virus
to at least one drug may comprise at least one primer selected from SEQ ID No
1-12 and 17-22. Optionally, additional reagents for performing the
nucleic amplification and subsequent sequence analysis may be added.
Reagents for cycle sequencing may be included. The primers may be
fluorescently labelled.
The instant invention provides a method of identifying a drug effective
against HIV integrase comprising: i) obtaining at least one HIV integrase
sequence, ii) determining the phenotypic response of the integrase towards
said drug, iii) using said phenotypic response to determine the
effectiveness of said drug. The phenotypic response is determined according
to the methods of the instant invention.
The methods described in the instant invention may be used in a method of
identifying a drug effective against HIV integrase comprising: i) obtaining
at least one HIV integrase sequence, determining the sequence of said HIV
integrase, ii) comparing said sequence with sequences present in a database
of which the susceptibility has been determined of the HIV integrase, iii)
using said sequence comparison to determine the effectiveness of said drug.
The susceptibility and the sequence of the HIV integrase gene are determined
according to the methods disclosed in the instant invention.
The genotyping and phenotyping methods as described herein can be used to
create a genotypic and phenotypic database of IN sequences, comprising: i)
obtaining samples comprising HIV RNA comprising the IN gene or a portion
thereof; ii) reverse-transcribing and amplifying said HIV RNA with primers
specific for the IN region of the HIV genome to obtain an amplicon
comprising the IN gene or a portion thereof; iii) determining the nucleotide
sequence of the amplicon or portions thereof; iv) generating a plasmid
comprising the wild-type HIV sequence with a deletion in the IN region of
the HIV genome characterized in that said deletion is generated using
nucleic acid amplification; v) preparing recombinant virus by homologous
recombination or ligation between the amplicon and a plasmid comprising the
wild-type HIV sequence with a deletion in the IN region of the HIV genome,
characterised in that said deletion is introduced using PCR; vi) determining
the relative replicative capacity of the recombinant virus in the presence
of anti-HIV drugs compared to an HIV virus with a wild-type IN gene
sequence; vii) correlating the nucleotide sequence and relative replicative
capacity in a data table.
According to the methods described herein a database may be constructed
comprising genotypic and phenotypic data of the HIV integrase, wherein the
database further provides a correlation between genotypes and between
genotypes and phenotypes, wherein the correlation is indicative of efficacy
of a given drug regimen. A database of IN sequences may be created and used
as described in WO 01/79540. For example, such a database may be analysed in
combination with pol and pro sequence information and the results used in
the determination of appropriate treatment strategies. Said database
containing a collection of genotypes, phenotypes and samples for which the
combined genotype/phenotype are available may be used to determine the
virtual phenotype (see supra). In addition, instead of interrogating the
complete IN sequences, particular codons correlating to a change in drug
susceptibility of the virus may be interrogated in such database.
A primer may be chosen from SEQ ID No 1-23. A particular set of
primers is SEQ ID 1-10, 13, 15, and 23. Primers specific for the IN region
of the HIV genome such as the primers described herein and their homologs
are claimed. The primer sequences listed herein may be labelled. Suitably,
this label may be detected using fluorescence, luminescence or absorbance.
The primer for creating a deletion construct may contain a portion that does
not anneal to the HIV sequence. That portion may be used to introduce a
unique restriction site. Interestingly, primers may be designed in which the
unique restriction site is partially present in the HIV sequence. The
primers are chosen from those listed herein or have at least 80% homology as
determined by methods known by the person skilled in the art such BLAST or
FASTA. Specifically, the homology is at least 90%, more specifically, at
least 95%. In addition, primers located in a region of 50 nucleotides (nt)
upstream or downstream from the sequences given herein constitute part of
the invention. Especially, said region is 20 nucleotides up or downstream
from the position in the HIV genome of the primer sequences given herein.
Alternatively, primers comprising at least 8 consecutive bases present in
either of the primers described here constitute one embodiment of the
invention. Interestingly, the primers comprise at least 12 consecutive bases
present in either of the primers described herein.
The present invention comprises the plasmids described in the experimental
part and the use of the plasmids in the methods described herein. The HIV
sequence incorporated in the plasmid may be based on the K03455 sequence.
The complete HIV sequence may be incorporated or only part thereof. A
suitable plasmid backbone may be selected from the group including pUC, pSV
or pGEM.
A plasmid comprising a deleted integrase, wherein the deletion comprises at
least 100 bp of the HIV integrase gene is provided herein. Suitably, more
that 500 bp of the integrase gene are deleted, more suitably the complete IN
gene is deleted. The deletion may also comprise parts of flanking genes, or
eventually more than one gene, e.g. deletion of integrase and protease.
To prepare vectors containing recombinant IN coding sequences, the patient
derived IN RNA can be reverse transcribed and amplified by the polymerase
chain reaction (PCR), then inserted into a vector containing the wild type
HIV genome sequence but lacking a complete IN coding region. Initially 36
different primer combinations were used to obtain amplified DNA sequences
from 16 patient samples. The 5′ to 3′ sequences and the primers identified
by SEQ ID's NO 1-10 of primers that can be successfully used to reverse
transcribe and PCR amplify IN coding regions are listed below in Table 1.
A number of reverse transcription and PCR protocols known in the art may be
used in the context of the present invention. A nested PCR approach to
amplify the patient derived cDNA after reverse transcription may be used as
described in Kellam, P. and Larder, B. A. , (Antimicrobial Agents and
Chemotherapy 38: 23-30 (1994)), which is incorporated herein by reference.
The nested approach of the instant invention utilizes two sets of primers,
the outer primers are 5′EGINT1 (SEQ ID NO 1) and 3′EGINT 10 (SEQ ID NO 11),
while the inner primers are 5′EGINT107 (SEQ ID NO 2) and 3′EGINT11 (SEQ ID
NO 12). An additional inner 5′ primer, 5′EGINT2 (SEQ ID NO 3), may also be
used as a "rescue primer" to improve the yield of amplified DNA.
Amplification using these primers yields a PCR product encompassing the
complete IN coding sequence. Alternatively, 5′EGINT3 (SEQ ID NO 4) and
3′EGINT10 (SEQ ID NO 11) are used as outer PCR primers, while 5′EGINT4 (SEQ
ID NO 5) or 5′EGINT5 (SEQ ID NO 6) and 3′EGINT6 (SEQ ID NO 7) are used as
inner primers, yielding a PCR product encompassing a portion of the IN
coding sequence.
| TABLE 1 |
| Primers for IN reverse transcription and PCR amplification. |
| Primer |
|
|
| Name |
5′ to 3′ sequence |
SEQ ID NO |
| R-IN-vif and IN outer and inner primers |
| 5′EGINT1 |
GGTACCAGTTAGAGAAAGAACCCA |
SEQ ID NO:1 |
| 5′EGINT107 |
GGAGCAGAAACCTTCTATGTAGATG |
SEQ ID NO:2 |
| 5′EGINT2 |
GGCAGCTAACAGGGAGACTAA |
SEQ ID NO:3 |
| 5′EGINT3 |
GGAATCATTCAAGCACAACCAGA |
SEQ ID NO:4 |
| 5′EGINT4 |
TCTGGCATGGGTACCAGCACA |
SEQ ID NO:5 |
| 5′EGINT5 |
AGGAATTGGAGGAAATGAACAAGTA |
SEQ ID NO:6 |
| 3′EGINT6 |
GTTCTAATCCTCATCCTGTCT |
SEQ ID NO:7 |
| 3′EGINT7 |
CCTCCATTCTATGGAGTGTCTATA |
SEQ ID NO:8 |
| 3′EGINT8 |
GGGTCTACTTGTGTGCTATATCTC |
SEQ ID NO:9 |
| 3′EGINT9 |
CAGATGAATTAGTTGGTCTGCTA |
SEQ ID NO:10 |
| 3′EGINT10 |
CCT CCA TTC TAT GGA GAC TCC CTG |
SEQ ID NO:11 |
| 3′EGINT11 |
GCA TCC CCT AGT GGG ATG TG |
SEQ ID NO:12 |
| R-IN-vif deletion-mutagenesis primers |
| MUT-IN1 |
GGG TGA CAA CTT TTT GTC TTC CTC |
SEQ ID NO:13 |
| |
TAT |
| MUT-IN2 |
GGA TCC TGC AGC CCG GGA AAG CTA |
SEQ ID NO:14 |
| |
GGG GAT GGT TTT ATA |
| IN deletion-mutagenesis primers: |
| MUT-IN3 |
GGG CCT TAT CTA TTC CAT CTA AAA |
SEQ ID NO:15 |
| |
ATA GT |
| MUT-IN4 |
GGA TCC TGC AGC CCG GGA TTA TGG |
SEQ ID NO:16 |
| |
AAA ACA GAT GGC A |
| IN_SEQ1F |
AGT CAG TGC TGG AAT CAG G |
SEQ ID NO:17 |
| IN_SEQ2F |
TTC CAG CAG AAA CAG GGC AG |
SEQ ID NO:18 |
| IN_SEQ3F |
GTA GAC ATA ATA GCA ACA GAC |
SEQ ID NO:19 |
| IN_SEQ1R |
CCC TGA AAC ATA CAT ATG GTG |
SEQ ID NO:20 |
| IN_SEQ2R |
CTG CCA TTT GTA CTG CTG TC |
SEQ ID NO:21 |
| IN_SEQ1R |
TGA ACT GCT ACC AGG ATA AC |
SEQ ID NO:22 |
| The underlined portions do not anneal to the sequence to be
amplified. |
To prepare recombinant vectors comprising the amplified patient-derived
IN sequences, these sequences can be inserted into vectors comprising the
wild-type HIV sequence and a deletion of all or part of the IN coding
region. The wild type HIV sequence can be obtained from a plasmid such as
pSV40HXB2D that is capable of transfecting lymphocyte cells to produce
viable virus particles. A deletion of the entire IN coding region on the
pSV40HXB2D vector may effectively be created by PCR amplifying the plasmid
using primers annealing to sequences at or near the ends of the IN coding
region in the vector. The amplified product can be cleaved with a
restriction enzyme introduced into the primers, then re-ligated to create a
pSV40HXB2D-based IN deletion vector with a unique restriction site at the
location of the deletion. The IN deletion vector can have a deletion of the
complete IN coding sequence, optionally with part of the preceding RNase
and/or subsequent Vif coding sequences also deleted. Alternatively, a
partial deletion of the IN coding sequence is created. This restriction site
is unique for the complete plasmid including the HIV gene. An example of
such restriction site is the SmaI restriction site. Interestingly, the
primers for creating a deletion construct are selected from SEQ ID No
13-16.
Those of skill in the art will appreciate that several types of HIV vectors
and cloning procedures known in the art may be used to create IN deletion
plasmids for recombination or ligation with patient derived sequences and
creation of infectious viruses. Generally, such vectors must be created to
allow re-insertion of the deleted sequences without disrupting the reading
frame of the gag-pol gene.
The amplified IN sequences may be inserted into the appropriate vector by
homologous recombination between overlapping DNA segments in the vector and
amplified sequence. Alternatively, the amplified IN sequence can be
incorporated into the vector at a unique restriction site according to
cloning procedures standard in the art. This latter is a direct cloning
strategy.
Claim 1 of 6 Claims
1. A method for determining the susceptibility of at least one HIV to at
least one drug, comprising:
i) obtaining at least one sample comprising HIV RNA from a patient,
wherein the sample comprises at least one IN gene or a portion thereof;
ii) reverse-transcribing and amplifying said HIV RNA with primers specific
for the IN region of the HIV genome to obtain an amplicon comprising the
IN gene or a portion thereof, wherein at least one primer is selected from
SEQ ID NO: 1-12 and 17-22;
iii) determining the nucleotide sequence of the amplicon or a portion
thereof, and
iv) comparing the nucleotide sequence of the amplicon to the sequence of
known HIV sequences to estimate the susceptibility of at least one HIV to
as least one drug.
____________________________________________
If you want to learn more
about this patent, please go directly to the U.S.
Patent and Trademark Office Web site to access the full
patent.
|