Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 

 

 

Link:  Pharm/Biotech Resources


Title:  3′terminal sequence of hepatitis C virus genome and diagnostic and therapeutic uses thereof

United States Patent:  6,943,246

Issued:  September 13, 2005

Inventors:  Rice; Charles M. (University City, MO); Kolykhalov; Alexander A. (St. Louis, MO)

Assignee:  Washington University (St. Louis, MO)

Appl. No.:  158314

Filed:  May 30, 2002

Abstract

The invention relates to the discovery of a novel RNA sequence at the 3′ terminal sequence of hepatitis C virus (HCV) genome RNA. Included in the invention are the 3′ sequence, its complement, and their use for nucleic-acid based diagnostics and for developing and evaluating novel anti-HCV therapies. This sequence element, which is conserved among HCV genotypes, is likely to be essential for viral replication, and required for construction of full-length HCV cDNA clones capable of yielding infectious RNA, progeny virus or replication-competent HCV replicons. Such functional clones are useful tools for evaluation of therapeutic approaches and as substrates for developing candidate attenuated or inactivated HCV derivatives for vaccination against HCV.

SUMMARY OF THE INVENTION

In view of the aforementioned deficiencies attendant with prior art HCV cDNA clones and cell culture systems for the analysis of HCV replication, and for the development of therapeutic compositions therefor, it is evident that there exists a need in the art for identification of particularly the 3′ terminal sequence of HCV which can be incorporated into a full-length cDNA clone capable of yielding infectious RNA transcripts, which then can be used as target sequences for the production of attenuated HCV for vaccines, and which can be used as targets for therapeutic compositions.

In accordance with the present invention, nucleotide sequences derived from cloned cDNA are provided which encode an HCV 3′ terminal RNA element. The newly discovered 3′ element in particular is highly conserved among HCV genotypes, and is a general feature of the HCV RNA genome.

The present invention includes a poly (UC) tract followed by a 101 nucleotide 3′ terminal RNA sequence element, and to full-length HCV viral genome RNA or derived HCV RNA replicons containing the following sequence:

5′- poly (UC) - AAUGGUGGCUCCAUCUUAGCCCUAGUCACGGCUA (SEQ ID NO:1).  
        GCUGUGAAAGGUCCGUGAGCCGCAUGACUGCAGA
        GAGUGCUGAUACUGGCCUCUCUGCUGAUCAUGU -3′

The present invention also relates to the complement of this RNA sequence and to full-length HCV negative-sense RNAs containing the following sequence:

5′- ACAUGAUCAGCAGAGAGGCCAGUAUCAGCACUCUCUGCAGUCAUGCGG (SEQ ID NO:2).  
CUCACGGACCUUUCACAGCUAGCCGUGACUAGGGCUAAGAUGGAGCCA
CCAUU-poly (GA) -3′

The present invention also relates to the DNA sequence corresponding to the 3′ NTR element in the positive-sense HCV genome RNA:

5′- poly - (TC) - AATGGTGGCTCCATCTTAGCCCTAGTCACGGCTAGCTGTGAAAGGTCCGT (SEQ ID NO:3).  
GAGCCGCATGACTGCAGAGAGTGCTGATACTGGCCTCTCTGCTGATCATGT-3′

The present invention also relates to the DNA sequence corresponding to the complement of the 3′ NTR element present in negative-sense HCV RNA:

5′-ACATGATCAGCAGAGAGGCCAGTATCAGCACTCTCTGCAGTCATGCGGCT (SEQ ID NO:4).  
CACGGACCTTTCACAGCTAGCCGTGACTAGGGCTAAGATGGAGCCACCA
TT-poly (GA)-3′

It should be appreciated, that although this sequence appears to "noncoding," it is possible that the sequence encodes a polypeptide of importance for HCV replication. There are two short open reading frames in the complement of the 3′ terminal element which would be at the 5′ of the negative-sense RNA followed by poly (A). These sequences could be expressed via translation of the negative strand RNA (either a full-length negative-strand or a subgenomic RNA).

In a further embodiment, this element, which extends beyond the previously accepted homopolymer tracts of poly(U) or poly(A), can be used to assemble full-length HCV cDNA clones for HCV-H and other HCV isolates (genotypes, types and subtypes) (HCV-1 acc.#M62321; HC-J1 acc.#D10749; HC-J acc.#D90208; HCV-BK acc.#M58335; HCV-H acc.#M67463; HC-J6 acc.#D00944; HC-J8 acc.#D01221; HC-J483 acc.#D13558; HC-J491 acc.#D10750; HC-C2 acc.#D10934; HCV-K acc.#X61596; HCV-N acc.#S62220; HCV-T acc.#M84745; HCV-JT acc.#D01171;HCV-JT acc.#D01172;HC-G9acc.#D14853;HCV-K3a acc.#D28917; NZL1 acc.#D17763; HCV-Tr acc.#D26556). Such full-length viruses or derived HCV RNA replicons are useful for the study of HCV replication and virus-host interactions as well as for the development of screening assays for HCV therapeutics and the evaluation of therapeutic compounds.

In a still further embodiment, live-attenuated strains of HCV are provided for use as vaccines.

The present invention also relates to a recombinant DNA or RNA molecule or a degenerate variant thereof, which encodes the 3′ HCV terminal sequence element; preferably the nucleic acid contains a sequence with substantially the same nucleotide sequence as SEQ ID NOS:1-4 or that shown in FIG. 3 (SEQ ID NOS:20-24; the parts of sequences downstream of the poly (U) tract only), FIG. 6 (SEQ ID NOS:28-31) and FIG. 8 (SEQ ID NOS:33-36) and sequences forming a secondary structure similar to that of FIG. 4 (SEQ ID NO:25), or alternatively, a structure which may be formed via interaction of the 3′ terminal sequence element (or its compliment) with other HCV RNA sequences (e.g., 5′ terminal sequences or other sequences at or near the 3′ NTR).

The sequences of the HCV of the present invention or portions thereof, may be prepared as probes (or primers for RT-PCR) to screen for complementary sequences and related clones in the same or alternate species. The present invention extends to probes or primers so prepared that may be provided for screening cDNA libraries, plasma or infected cells for HCV. For example, the probes may be prepared synthetically and by recombinant DNA with a variety of known vectors, such as the phage, plasmid or viral vector. The present invention also includes the preparation of plasmids including such vectors, and the use of the DNA/RNA sequences to construct vectors expressing antisense RNA or ribozymes which would attack natural or engineered HCV RNAs containing any or all of the sequences set forth in FIG. 3 (SEQ ID NOS:20-24), FIG. 6 (SEQ ID NOS:28-31) and FIG. 8 (SEQ ID NOS:33-36) or as above as SEQ ID NOS:1-4, derivatives of the sequences, or homologous sequences from other HCV types/subtypes. Correspondingly, the preparation of antisense RNA and ribozymes are included herein.

The present invention also includes RNA molecules having the properties noted herein, and that display the sequences set forth and described above and selected from SEQ ID NOS:1-4, 20-24, 28-31 and 33-36.

In a further embodiment of the invention, the full nucleotide sequence of the HCV containing the above determined sequences may be introduced into an appropriate host. The invention accordingly extends to host cells transfected or transformed with the cloned HCV sequences and/or RNA derived therefrom, and more particularly, replication competent and/or complete DNA/RNA sequences assembled using the sequences, or homologous derivatives set forth above.

According to other preferred features of certain preferred embodiments of the present invention, a transiently transfected or stable cell line is provided to produce infectious HCV, and attenuated strains of HCV.

The present invention naturally contemplates several means for preparation of the HCV sequences, including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope. The isolation of the sequences disclosed herein facilitates the reproduction of not only the nucleic acid sequences themselves, but also infectious HCV, and attenuated HCV by such recombinant techniques, and accordingly, the invention extends to the wild type and attenuated HCVs so prepared from the disclosed sequences, and to transiently transfected cells or stable cell lines expressing this sequence, replicating HCV RNA, and/or producing virus.

The invention includes an assay system for screening of potential drugs effective to modulate replication of HCV in target cells by interrupting or potentiating the viral life cycle. Potentiation would be desirable where stocks of HCV were to be produced, for use in experimental as well as therapeutic regimes (i.e., vaccines). In one instance, the test drug could be administered to a cellular sample transfected with an infectious HCV, cDNA clone or replication-competent RNA, to determine its effect upon the replicative activity of the HCV in the presence of any chemical sample (including DNA or RNA), or to the test drug, by comparison with a control.

The assay system could more importantly be adapted to identify drugs or other entities that are capable of binding to the HCV RNA sequences or which bind essential factors interacting with these sequences, thereby inhibiting or potentiating replication. Such assays would be useful in the development of drugs that would be specific against a wide range of HCV isolates, due to the conservation of an important 3′ terminal sequence motif, identified by SEQ ID NOS:1-4.

In yet a further embodiment, the invention contemplates antagonists of the activity of HCV, in particular, an agent or molecule that inhibits viral replication or transcriptional activity in general. In a specific embodiment, the antagonist can be an oligonucleotide having the sequence (or its complement) of a portion of a 3′ terminal domain of an HCV. Such oligonucleotides may be capable of disrupting strand synthesis required for viral replication, translation of HCV RNA into protein, or packaging of genome RNA into virus particles.

The diagnostic utility of the present invention extends to the use of the present 3′ terminal sequence in assays to screen for HCV infection. In particular, probes or PCR primers may be produced which are capable of detecting HCV infection in blood, or in infected cells. Such probes may be labelled with any detectable label. In the instance where a radioactive label, such as the isotopes 3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 125I, 131I, and 186Re are used, known currently available counting procedures may be utilized. In the instance where the label is an enzyme, detection may be accomplished by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques known in the art.

The present invention includes an assay system which may be prepared in the form of a test kit for the quantitative analysis of the extent of the presence of the HCV sequences, or to identify drugs or other agents that may mimic or block the activity of such sequences. The system or test kit may comprise a labeled component prepared by one of the radioactive and/or enzymatic techniques discussed herein, coupling a label to a probe for HCV nucleic acid, or a binding partner thereof, or a binding partner of the HCV virion itself, and one or more additional immunochemical reagents, at least one of which is a free or immobilized ligand, capable either of binding with the labeled component, its binding partner, one of the components to be determined or their binding partner(s).

In a further embodiment, the present invention relates to certain therapeutic methods which would be based upon the activity of the HCV sequences(s), or active fragments thereof, or upon agents or other drugs determined to possess the same activity. A first therapeutic method is associated with the prevention of infection by HCV, in particular by providing a vaccine composed of an attenuated HCV, designed by mutating the sequence elements disclosed herein.

More specifically, the therapeutic method generally referred to herein could include the method for the treatment of hepatitis or other cellular dysfunctions caused by HCV by the administration of pharmaceutical compositions that may comprise effective inhibitors of the HCV or its subunits, or other equally effective drugs developed for instance by a drug screening assay prepared and used in accordance with a further aspect of the present invention. For example, drugs or other binding partners to the HCV nucleic acid or its encoded proteins, may be administered to inhibit or potentiate transcriptional activity.

In particular, HSV or its herein-identified 3′ sequence element or fragments thereof, and binding partners thereto could be prepared in pharmaceutical formulations for administration in instances wherein interferon therapy is appropriate, such as to treat chronic viral hepatitis or other HCV-associated illnesses.

Accordingly, it is a principal object of the present invention to provide a novel 3′ sequence element of HCV, as well as full-length HCV genomes which encode wild-type or attenuated HCV bearing this additional sequence.

It is a further object of the present invention to provide a method for detecting the presence of the HCV in mammals in which HCV is suspected to be present.

It is a further object of the present invention to provide a method and associated assay system for screening substances such as drugs, agents and the like, potentially effective in combating the adverse effects of the HCV in mammals.

It is a still further object of the present invention to provide a method for the treatment of mammals to control the amount or activity of the HCV or fragments thereof, so as to alter the adverse consequences of such presence or activity.

It is a still further object of the present invention to provide a method for the treatment of mammals to control the amount or activity of the HCV or its subunits, so as to treat or avert the adverse consequences of a pathological state.

It is a still further object of the present invention to provide pharmaceutical compositions for use in therapeutic methods which comprise or are based upon the HCV, its sequence elements, their binding partner(s), or upon agents or drugs that control the production, or that mimic or antagonize the activities of the HCV.

 

Claim 1 of 14 Claims

1. An isolated polynucleotide sequence of at least 15 contiguous nucleic acids of a hepatitis C virus 3′ terminal sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36 or the complements thereof.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]