|
|

Link:
Pharm/Biotech Resources
Title: 3′terminal sequence of hepatitis C virus genome
and diagnostic and therapeutic uses thereof
United States Patent: 6,943,246
Issued: September 13, 2005
Inventors: Rice; Charles M. (University City, MO);
Kolykhalov; Alexander A. (St. Louis, MO)
Assignee: Washington University (St. Louis, MO)
Appl. No.: 158314
Filed: May 30, 2002
Abstract
The invention relates to the discovery of a novel RNA sequence at the 3′
terminal sequence of hepatitis C virus (HCV) genome RNA. Included in the
invention are the 3′ sequence, its complement, and their use for
nucleic-acid based diagnostics and for developing and evaluating novel anti-HCV
therapies. This sequence element, which is conserved among HCV genotypes, is
likely to be essential for viral replication, and required for construction
of full-length HCV cDNA clones capable of yielding infectious RNA, progeny
virus or replication-competent HCV replicons. Such functional clones are
useful tools for evaluation of therapeutic approaches and as substrates for
developing candidate attenuated or inactivated HCV derivatives for
vaccination against HCV.
SUMMARY OF THE INVENTION
In view of the aforementioned deficiencies attendant with prior art HCV
cDNA clones and cell culture systems for the analysis of HCV replication,
and for the development of therapeutic compositions therefor, it is evident
that there exists a need in the art for identification of particularly the
3′ terminal sequence of HCV which can be incorporated into a full-length
cDNA clone capable of yielding infectious RNA transcripts, which then can be
used as target sequences for the production of attenuated HCV for vaccines,
and which can be used as targets for therapeutic compositions.
In accordance with the present invention, nucleotide sequences derived from
cloned cDNA are provided which encode an HCV 3′ terminal RNA element. The
newly discovered 3′ element in particular is highly conserved among HCV
genotypes, and is a general feature of the HCV RNA genome.
The present invention includes a poly (UC) tract followed by a 101
nucleotide 3′ terminal RNA sequence element, and to full-length HCV viral
genome RNA or derived HCV RNA replicons containing the following sequence:
| 5′- poly (UC) - AAUGGUGGCUCCAUCUUAGCCCUAGUCACGGCUA |
(SEQ ID NO:1). |
|
| GCUGUGAAAGGUCCGUGAGCCGCAUGACUGCAGA |
| GAGUGCUGAUACUGGCCUCUCUGCUGAUCAUGU -3′ |
The present invention also relates to the complement of this RNA sequence
and to full-length HCV negative-sense RNAs containing the following
sequence:
| 5′-
ACAUGAUCAGCAGAGAGGCCAGUAUCAGCACUCUCUGCAGUCAUGCGG |
(SEQ ID NO:2). |
|
| CUCACGGACCUUUCACAGCUAGCCGUGACUAGGGCUAAGAUGGAGCCA |
| CCAUU-poly (GA) -3′ |
The present invention also relates to the DNA sequence corresponding to
the 3′ NTR element in the positive-sense HCV genome RNA:
| 5′- poly - (TC) -
AATGGTGGCTCCATCTTAGCCCTAGTCACGGCTAGCTGTGAAAGGTCCGT |
(SEQ ID NO:3). |
|
|
GAGCCGCATGACTGCAGAGAGTGCTGATACTGGCCTCTCTGCTGATCATGT-3′ |
The present invention also relates to the DNA sequence corresponding to
the complement of the 3′ NTR element present in negative-sense HCV RNA:
| 5′-ACATGATCAGCAGAGAGGCCAGTATCAGCACTCTCTGCAGTCATGCGGCT |
(SEQ ID NO:4). |
|
| CACGGACCTTTCACAGCTAGCCGTGACTAGGGCTAAGATGGAGCCACCA |
| TT-poly (GA)-3′ |
It should be appreciated, that although this sequence appears to "noncoding,"
it is possible that the sequence encodes a polypeptide of importance for HCV
replication. There are two short open reading frames in the complement of
the 3′ terminal element which would be at the 5′ of the negative-sense RNA
followed by poly (A). These sequences could be expressed via translation of
the negative strand RNA (either a full-length negative-strand or a
subgenomic RNA).
In a further embodiment, this element, which extends beyond the previously
accepted homopolymer tracts of poly(U) or poly(A), can be used to assemble
full-length HCV cDNA clones for HCV-H and other HCV isolates (genotypes,
types and subtypes) (HCV-1 acc.#M62321; HC-J1 acc.#D10749; HC-J acc.#D90208;
HCV-BK acc.#M58335; HCV-H acc.#M67463; HC-J6 acc.#D00944; HC-J8 acc.#D01221;
HC-J483 acc.#D13558; HC-J491 acc.#D10750; HC-C2 acc.#D10934; HCV-K
acc.#X61596; HCV-N acc.#S62220; HCV-T acc.#M84745; HCV-JT acc.#D01171;HCV-JT
acc.#D01172;HC-G9acc.#D14853;HCV-K3a acc.#D28917; NZL1 acc.#D17763; HCV-Tr
acc.#D26556). Such full-length viruses or derived HCV RNA replicons are
useful for the study of HCV replication and virus-host interactions as well
as for the development of screening assays for HCV therapeutics and the
evaluation of therapeutic compounds.
In a still further embodiment, live-attenuated strains of HCV are provided
for use as vaccines.
The present invention also relates to a recombinant DNA or RNA molecule or a
degenerate variant thereof, which encodes the 3′ HCV terminal sequence
element; preferably the nucleic acid contains a sequence with substantially
the same nucleotide sequence as SEQ ID NOS:1-4 or that shown in FIG. 3 (SEQ
ID NOS:20-24; the parts of sequences downstream of the poly (U) tract only),
FIG. 6 (SEQ ID NOS:28-31) and FIG. 8 (SEQ ID NOS:33-36) and sequences
forming a secondary structure similar to that of FIG. 4 (SEQ ID NO:25), or
alternatively, a structure which may be formed via interaction of the 3′
terminal sequence element (or its compliment) with other HCV RNA sequences
(e.g., 5′ terminal sequences or other sequences at or near the 3′ NTR).
The sequences of the HCV of the present invention or portions thereof, may
be prepared as probes (or primers for RT-PCR) to screen for complementary
sequences and related clones in the same or alternate species. The present
invention extends to probes or primers so prepared that may be provided for
screening cDNA libraries, plasma or infected cells for HCV. For example, the
probes may be prepared synthetically and by recombinant DNA with a variety
of known vectors, such as the phage, plasmid or viral vector. The present
invention also includes the preparation of plasmids including such vectors,
and the use of the DNA/RNA sequences to construct vectors expressing
antisense RNA or ribozymes which would attack natural or engineered HCV RNAs
containing any or all of the sequences set forth in FIG. 3 (SEQ ID
NOS:20-24), FIG. 6 (SEQ ID NOS:28-31) and FIG. 8 (SEQ ID NOS:33-36) or as
above as SEQ ID NOS:1-4, derivatives of the sequences, or homologous
sequences from other HCV types/subtypes. Correspondingly, the preparation of
antisense RNA and ribozymes are included herein.
The present invention also includes RNA molecules having the properties
noted herein, and that display the sequences set forth and described above
and selected from SEQ ID NOS:1-4, 20-24, 28-31 and 33-36.
In a further embodiment of the invention, the full nucleotide sequence of
the HCV containing the above determined sequences may be introduced into an
appropriate host. The invention accordingly extends to host cells
transfected or transformed with the cloned HCV sequences and/or RNA derived
therefrom, and more particularly, replication competent and/or complete
DNA/RNA sequences assembled using the sequences, or homologous derivatives
set forth above.
According to other preferred features of certain preferred embodiments of
the present invention, a transiently transfected or stable cell line is
provided to produce infectious HCV, and attenuated strains of HCV.
The present invention naturally contemplates several means for preparation
of the HCV sequences, including as illustrated herein known recombinant
techniques, and the invention is accordingly intended to cover such
synthetic preparations within its scope. The isolation of the sequences
disclosed herein facilitates the reproduction of not only the nucleic acid
sequences themselves, but also infectious HCV, and attenuated HCV by such
recombinant techniques, and accordingly, the invention extends to the wild
type and attenuated HCVs so prepared from the disclosed sequences, and to
transiently transfected cells or stable cell lines expressing this sequence,
replicating HCV RNA, and/or producing virus.
The invention includes an assay system for screening of potential drugs
effective to modulate replication of HCV in target cells by interrupting or
potentiating the viral life cycle. Potentiation would be desirable where
stocks of HCV were to be produced, for use in experimental as well as
therapeutic regimes (i.e., vaccines). In one instance, the test drug could
be administered to a cellular sample transfected with an infectious HCV,
cDNA clone or replication-competent RNA, to determine its effect upon the
replicative activity of the HCV in the presence of any chemical sample
(including DNA or RNA), or to the test drug, by comparison with a control.
The assay system could more importantly be adapted to identify drugs or
other entities that are capable of binding to the HCV RNA sequences or which
bind essential factors interacting with these sequences, thereby inhibiting
or potentiating replication. Such assays would be useful in the development
of drugs that would be specific against a wide range of HCV isolates, due to
the conservation of an important 3′ terminal sequence motif, identified by
SEQ ID NOS:1-4.
In yet a further embodiment, the invention contemplates antagonists of the
activity of HCV, in particular, an agent or molecule that inhibits viral
replication or transcriptional activity in general. In a specific
embodiment, the antagonist can be an oligonucleotide having the sequence (or
its complement) of a portion of a 3′ terminal domain of an HCV. Such
oligonucleotides may be capable of disrupting strand synthesis required for
viral replication, translation of HCV RNA into protein, or packaging of
genome RNA into virus particles.
The diagnostic utility of the present invention extends to the use of the
present 3′ terminal sequence in assays to screen for HCV infection. In
particular, probes or PCR primers may be produced which are capable of
detecting HCV infection in blood, or in infected cells. Such probes may be
labelled with any detectable label. In the instance where a radioactive
label, such as the isotopes 3H, 14C, 32P,
35S, 36Cl, 51Cr, 57Co, 58Co,
59Fe, 90Y, 125I, 131I, and
186Re are used, known currently available counting procedures may be
utilized. In the instance where the label is an enzyme, detection may be
accomplished by any of the presently utilized colorimetric,
spectrophotometric, fluorospectrophotometric, amperometric or gasometric
techniques known in the art.
The present invention includes an assay system which may be prepared in the
form of a test kit for the quantitative analysis of the extent of the
presence of the HCV sequences, or to identify drugs or other agents that may
mimic or block the activity of such sequences. The system or test kit may
comprise a labeled component prepared by one of the radioactive and/or
enzymatic techniques discussed herein, coupling a label to a probe for HCV
nucleic acid, or a binding partner thereof, or a binding partner of the HCV
virion itself, and one or more additional immunochemical reagents, at least
one of which is a free or immobilized ligand, capable either of binding with
the labeled component, its binding partner, one of the components to be
determined or their binding partner(s).
In a further embodiment, the present invention relates to certain
therapeutic methods which would be based upon the activity of the HCV
sequences(s), or active fragments thereof, or upon agents or other drugs
determined to possess the same activity. A first therapeutic method is
associated with the prevention of infection by HCV, in particular by
providing a vaccine composed of an attenuated HCV, designed by mutating the
sequence elements disclosed herein.
More specifically, the therapeutic method generally referred to herein could
include the method for the treatment of hepatitis or other cellular
dysfunctions caused by HCV by the administration of pharmaceutical
compositions that may comprise effective inhibitors of the HCV or its
subunits, or other equally effective drugs developed for instance by a drug
screening assay prepared and used in accordance with a further aspect of the
present invention. For example, drugs or other binding partners to the HCV
nucleic acid or its encoded proteins, may be administered to inhibit or
potentiate transcriptional activity.
In particular, HSV or its herein-identified 3′ sequence element or fragments
thereof, and binding partners thereto could be prepared in pharmaceutical
formulations for administration in instances wherein interferon therapy is
appropriate, such as to treat chronic viral hepatitis or other HCV-associated
illnesses.
Accordingly, it is a principal object of the present invention to provide a
novel 3′ sequence element of HCV, as well as full-length HCV genomes which
encode wild-type or attenuated HCV bearing this additional sequence.
It is a further object of the present invention to provide a method for
detecting the presence of the HCV in mammals in which HCV is suspected to be
present.
It is a further object of the present invention to provide a method and
associated assay system for screening substances such as drugs, agents and
the like, potentially effective in combating the adverse effects of the HCV
in mammals.
It is a still further object of the present invention to provide a method
for the treatment of mammals to control the amount or activity of the HCV or
fragments thereof, so as to alter the adverse consequences of such presence
or activity.
It is a still further object of the present invention to provide a method
for the treatment of mammals to control the amount or activity of the HCV or
its subunits, so as to treat or avert the adverse consequences of a
pathological state.
It is a still further object of the present invention to provide
pharmaceutical compositions for use in therapeutic methods which comprise or
are based upon the HCV, its sequence elements, their binding partner(s), or
upon agents or drugs that control the production, or that mimic or
antagonize the activities of the HCV.
Claim 1 of 14 Claims
1. An isolated polynucleotide sequence of at least 15 contiguous nucleic
acids of a hepatitis C virus 3′ terminal sequence selected from the group
consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ
ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36 or the
complements thereof.
____________________________________________
If you want to learn more
about this patent, please go directly to the U.S.
Patent and Trademark Office Web site to access the full
patent.
|