This invention comprises a recombinant protein comprising the maltose binding protein (MBP) of Escherichia coli fused to amino acids 5-337 of the FlaA flagellin of Campylobacter coli VC167 which has provided evidence of immunogenicity and protective efficacy against challenge by a heterologous strain of campylobacter, Campylobacter jejuni 81-176 in mammals. The invention further comprises a recombinant DNA construct encoding the immunodominant region (region I through III) of flagellin from Campylobacter spp. for use as a component of a vaccine against Campylobacter diarrhea. The invention therefore represents an effective treatment against Campylobacter but avoids inducing the autoimmune Guillain Barre Syndrome (GBS), a post-infection polyneuropathy caused by Campylobacter molecular mimicry of human gangliosides which has hampered the development of vaccines heretofore.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a construct of a recombinant DNA containing a fragment of a bacterial gene and the expression of the constructs for use as a vaccine or a component of a vaccine. Moreover, the invention relates to a recombinant protein comprising the maltose binding protein (MBP) of Escherichia coli fused to amino acids 5-337 of the FlaA flagellin of Campylobacter coli VC167.

2. Description of the Prior Art

The genus Campylobacter are gram-negative, curved, spiral or S-shaped or, in some cases, coccoid, bacteria. Campylobacter have a single polar, unsheathed flagellum at one or both ends which imparts a characteristic darting or cork-screw motility. Campylobacter are a major cause of gastroenteritis in both developed and developing countries (1,2). The major enteric pathogens in the genus are C. jejuni and C. coli. All can be normally present in the gastrointestinal tract of domestic and wild animals which act as a major reservoir for infection in humans. Human infection with Campylobacter occurs via:

• 1) animal to human contact especially farm animals such as poultry;
• 2) human to human transmission especially from infected children;
• 3) food contamination;
• 4) water contaminated with excreta from animals.

Campylobacter infection can produce both an inflammatory diarrhea and a non-inflammatory diarrhea. The infection is more likely to be of the non-inflammatory type, without fever or bloody diarrhea. However, severe bloody diarrhea resembling bacillary dysentery can occur and frequently is seen in travelers to developing countries.

Although Campylobacter diarrhea is treatable with antibiotics, an effective vaccine against the organism is much preferred. This is especially true for travelers to regions where the disease is endemic and for use by developing nations where antibiotics are not always available or where their cost prohibits their use by the general population. There are, however, no currently licensed vaccines available against these organisms.

An important, possible contraindication of whole cell Campylobacter vaccine is the potential for development of Guillain-Barre Syndrome (GBS) (3), a post-infectious polyneuropathy, in vaccinated individuals. There are several reports indicating that prior infection with C. jejuni can result in acquisition of immunity (10,11). However, development of vaccines has been hampered by a lack of understanding of the basic virulence mechanisms and by the antigenic complexity of these organisms. For example, the serotyping scheme developed by Lior (12) is based on heat labile (HL) antigens and has over 100 recognized serogroups. The heat stable serotyping scheme of Penner (41), which is thought to be based on lippolysaccharides (LPS), has over 70 serotypes. The LPS cores of many serotypes have been shown to contain sialic acid in structures which resemble human gangliosides (13). This molecular mimicry has been implicated in development of autoantibodies leading to GBS, although the specific structure or structures which enable a given campylobacter strain to cause GBS are not clear. Strain 81-176 belongs to Serogroup O:23,36. Strains of O:23 and O:36 have been shown to contain ganglioside-like structures in their lipopolysaccharides. Although some O serotypes of C. jejuni are implicated with inducing GBS, O serotyping alone is insufficient in determining the potential for a given strain to induce GBS. Also, there is insufficient information to determine definitively the ability of any Campylobacter strain to lead to development of GBS.

A formalin fixed whole cell vaccine of C. jejuni 81-176 adjuvanted with mutant E. coli heat labile enterotoxin (LT _R192G; 12) is currently in human testing (14,15). This formulation appears to offer protection against homologous challenge in animal models (23,9), but the ability to protect against multiple serotypes of C. jejuni remains to be determined. Moreover, given the lack of understanding about the pathogenesis of Campylobacter associated GBS, there are concerns about use of whole cell preparations of campylobacter as vaccines. This concern becomes more compelling if multiple strains, which are less well characterized than 81-176, were to be combined in order to generate broad cross-serotype specific protection. An alternate approach would be to utilize a single campylobacter protein, either as a recombinant subunit vaccine or expressed in a carrier vaccine strain, to elicit protection against multiple serotypes of Campylobacter. Therefore, there exists in the current state-of-the-art, the question whether specific Campylobacter strains, used in whole-cell vaccines or whole-cell vaccine candidates, could potentiate GBS and therefore be safe for vaccine use. One candidate for inclusion into such vaccines is flagellin.

Flagellin is a component of flagella, which provides swimming motility on many bacterial species including Campylobacter. Flagellin is the immunodominant antigen recognized during human and experimental animal infections (16,17,18) with Campylobacter. The structure of flagellin has been determined experimentally using the Campylobacter coli strain VC167 as a model. The flagella of this organism is complex, composed of multiple species of flagellin subunits, FlaA and FlaB (4-6). The FlaA and FlaB subunits are encoded by two genes, flaA and flaB, that are located adjacent to one another in a tandem orientation (FIG. 1). The expression of these genes is concomitant and unit length rather than polycistronic. The flaA flagellin gene, which encodes the major flagellin subunit in the complex flagellar filament, has been divided into five regions (5) based on restriction enzyme mapping. Regions I-III encode the most highly conserved regions of the protein among different Campylobacter flagellin genes and are also the most immunodominant region of the protein (7).

Because of the potentially harmful effects of using whole-cell Campylobacter vaccines, it was concluded that an effective vaccine against this organism was needed that, at the same time, did not induce the deleterious autoimmune responses.

SUMMARY OF THE INVENTION

Accordingly, an object of this invention is a recombinant construct and expressed protein possessing highly immunogenic regions of the flagellar subunit but which did not contain antigenic moieties which induce GBS.

Another object of this invention is a recombinant protein, encoded by a portion of the flaA flagellin gene of Campylobacter coli VC167 consisting essentially of nucleotides 1-999 of SEQ ID NO.: 1 and corresponding to amino acid residues 1-333 of the amino acid sequence of SEQ ID NO: 238.

Yet another object of the invention is a product that can be expressed in different host backgrounds of bacterial strains belonging to the family Enterobacteriaceae for use in different vaccine formulations against Campylobacter.

An additional object of this invention is the induction of a host immune response by purified recombinant flagellin expressed in E. coli.

A further object is the cross-reactivity of antibodies, induced by purified recombinant flagellin expressed in E. coli, with flagellins from C. coli (VC167) and other strains of Campylobacter spp.

Another object is that the purified recombinant flagellin expressed in E. coli is capable of protecting animals from disease and intestinal colonization by a heterologous strain, Campylobacter jejuni 81-176.

A still further object is the use of the construct in vaccine preparations against diarrhea yet reducing the potential for GBS.

Another object is the use of the contstruct in vaccine preparations in order to reduce intestinal colonization.

These and other objects of the invention are accomplished by a recombinant DNA construct encoding the immunodominant region (regions I through III) of flagellin from Campylobacter spp. for use as a component of a vaccine against Campylobacter disease.

DETAILED DESCRIPTION OF THE INVENTION

Currently, no efficacious vaccine exists for Campylobacter disease. The potential for GBS complicates using attenuated strains of Campylobacter as a vaccine. It is critical therefore, that a vaccine be produced that is both capable of eliciting a vigorous protective immune response but does not lead to GBS.

Sub-unit vaccines hold a great deal of promise in fulfilling both these important criteria. One of the most highly immunogenic exposed regions of Campylobacter is the flagellin proteins, in particular the products of the genes flaA and flaB. The flaA gene of Campylobacter has been divided into five regions (5) based on restriction enzyme maps. This region of the flaA gene contains both highly conserved and variable regions among Campylobacter species. The preferred embodiment of this invention encompasses the gene sequence and expression from 13 through 1,015 base pairs of the flaA gene of C. coli (6), covering regions I, II and III as shown in FIG. 2, and segments within this region. This gene sequence is used to produce a recombinant Campylobacter polypeptide, which if introduced into a host is capable of producing an immunological response. The FlaA flagellin is the major protein subunit comprising the flagella filament or locomotory organelle of Campylobacter spp.

Region I of the flaA gene represents the highly conserved N terminal region, and regions II and III represent two regions which are more variable among different sequenced flagellin genes. Regions II and III are not, however, as variable as region IV. The construct was made by amplifying the regions I, II and III using the primer flaA-11 (5′ACCAATATTAACACAAATGTTGCAGCA3′) (Seq. ID no. 3) and flaA-2 (5′TTATCTAGACTAATCTCTACCATCATTTTTAAC3′) (Seq. ID no.4). The PCR product is digested with the appropriate restriction enzymes in order to insert the product into an expression vector. Any plasmid expression vector, e.g. PET™ (Novogen, Madison Wis.) or PMAL™ (New England Biolabs, Beverly, Mass.) and viral expression vectors (e.g. adenovirus, M13, herpesvirus, vaccinia, baculovirus, etc) expression systems can be used as long as the polypeptide is able to be expressed. The PET™ vector is used for the cloning and over-expression of recombinant proteins in E. coli. In the PET™ system, the cloned gene is expressed under the control of a phage T7 promotor. In the PMAL™ protein fusion and purification system, the cloned gene is inserted into a PMAL™vector downstream from the MALE™ gene, which encodes maltose-binding protein (MBP). This results in the expression of an MBP-fusion protein. The technique uses the strong P_tac promotor and the translation initiation signals of LMBP to express large amounts of the fusion protein. The PMAL-C2™ series of vectors have an exact deletion of the MALE™ signal sequence, resulting in cytoplasmicexpression of the fusion protein. The PMAL-P2™ series of vectors contain the normal MALE™ signal sequence, which directs the fusion protein through the cytoplasmic membrane, resulting in periplasmic expression. The preferred expression system is the PMAL-C2™ vector (New England Biolabs, Beverly, Mass.). For insertion into this system the PCR product is digested with SspI and XbaI, purified by agarose gel electrophoresis, and cloned in a commercially available plasmid vector, PMAL-P2™ or PMAL-C2™ (New England Biolabs, Beverly, Mass.) which had been digested with XmnI and XbaI. This vector allows for fusion of the fifth codon of the flaA gene to an Escherichia coli gene encoding maltose binding protein (MBP). The MBP-FlaA fusion is transcriptionally regulated by a P_tac promotor and is induced by growth in isopropylthiogalactoside (IPTG). Several transformants of E. coli DH5-alpha, containing plasmids with the appropriate size insert, were sequenced with the MALE™ primer (New England Biolabs). The MALE™ primer is used for sequencing downstream from the malE gene across the polylinker. One plasmid with the expected fusion-protein in the correct reading frame to MALE™, termed pEB11-2, was purified.

The MBP-FlaA fusion protein was purified on the basis of the ability of the MBP portion of the molecule to bind to an amylose affinity column.
 

Claim 1 of 12 Claims

1. An isolated and purified polynucleotide sequence that is a portion of the flaA coding region of Campylobacter, said polynucleotide sequence consisting of nucleotides 1-999 of the DNA SEQ ID NO: 1, and said polynucleotide encoding an immunogenic polypeptide.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.