Nucleic acid molecule that comprise a hepatitis C nonstructural protein including specifically disclosed DNA sequences are disclosed. Pharmaceutical compositions that contain nucleic acid molecules comprising a hepatitis C nonstructural protein including a nucleotide sequence encoding NS3, NS4, or NS5, or a combination thereof, operably linked to regulatory elements functional in human cells are disclosed. Methods of immunizing individuals susceptible to or infected by hepatitis C virus comprising administering such pharmaceutical compositions are disclosed.

DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION

According to the present invention, compositions and methods are provided which prophylactically and/or therapeutically immunize or treat an individual against HCV infection. Recombinant nucleic acid molecules comprising a nucleotide coding sequence that encodes a HCV nonstructural protein, such as, for example, NS3, NS4, or NS5, or a combination thereof, are administered to the individual. The protein encoded by the recombinant nucleic acid gene construct is expressed by the individual's cells and serves as an immunogenic target against which an anti-HCV immune responses are elicited. The resulting immune responses are broad based; in addition to a humoral immune response, both arms of the cellular immune response are elicited. The methods of the present invention are useful for conferring prophylactic and therapeutic immunity. The methods of the present invention can also be practiced on mammals, other than humans, for biomedical research. Thus, the methods of the present invention can be employed to both immunize an individual from HCV challenge as well as treat an individual suffering from HCV infection.

As used herein, the phrase "HCV nonstructural protein" is meant to refer to HCV nonstructural proteins NS3, NS4, and NS5, and equivalents thereof. Equivalent proteins include peptide fragments of NS3, NS4, and NS5 which retain bioactivity as described herein. In addition, the term HCV nonstructural protein is meant to refer to corresponding HCV nonstructural proteins from additional HCV isolates which may vary in sequence. Those having ordinary skill in the art can readily identify the HCV nonstructural proteins from additional HCV isolates. It is to be understood that nucleotide substitutions in the codon may be acceptable when the same amino acid is encoded. In addition, it is also to be understood that nucleotide changes may be acceptable wherein conservative amino acid substitution(s) result from the nucleotide substitution(s). It is to be understood that the phrase "HCV nonstructural protein" also includes fusion proteins comprising the nonstructural protein, as well as therapeutically or prophylactically active fragments thereof.

As used herein, the phrase "gene construct" is meant to refer to a recombinant nucleic acid molecule comprising a nucleotide coding sequence that encodes a HCV nonstructural protein, as well as initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the vaccinated individual. In some embodiments, the gene construct further comprises an enhancer, Kozak sequence (GCCGCCATG; SEQ ID NO:1), and at least a fragment of the HCV 5' UTR.

As used herein, the phrase "genetic vaccine" refers to a pharmaceutical preparation that comprises a gene construct. Genetic vaccines include pharmaceutical preparations useful to invoke a prophylactic and/or therapeutic immune response to HCV.

As used herein, the phrase "nucleic acid" refers to DNA, RNA, or chimeras formed therefrom.

According to the present invention, gene construct(s) are introduced into the cells of an individual where it is expressed, thus producing at least one HCV nonstructural protein. Preferably, the regulatory elements of the gene constructs of the invention are capable of directing expression in mammalian cells, preferably human cells. The regulatory elements include a promoter and a polyadenylation signal. In addition, other elements, such as an enhancer and a Kozak sequence, may also be included in the gene construct.

When taken up by a cell, the gene constructs of the invention may remain present in the cell as a functioning extrachromosomal molecule or it may integrate into the cell's chromosomal DNA. Nucleic acid, such as DNA, may be introduced into cells where it remains as separate genetic material in the form of a plasmid. Alternatively, linear nucleic acid that can integrate into the chromosome may be introduced into the cell. When introducing nucleic acid into the cell, reagents which promote nucleic acid integration into chromosomes may be added. DNA sequences which are useful to promote integration may also be included in the DNA molecule. Alternatively, RNA may be administered to the cell. It is also contemplated to provide the gene construct as a linear minichromosome including a centromere, telomeres and an origin of replication.

According to the present invention, the gene construct comprises recombinant nucleic acid molecules comprising a nucleotide coding sequence that encodes a HCV nonstructural protein. In some preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes NS3. In other preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes a HCV nonstructural protein that comprises NS4. In other preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes a HCV nonstructural protein that comprises NS5. In other preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes any combination of HCV nonstructural proteins including NS3, NS4, and NS5.

In some preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes a HCV nonstructural protein that comprises a fragment of HCV NS3, NS4, or NS5 protein, or a combination thereof. The fragments include, but are not limited to, fragments containing 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 amino acids of the corresponding nonstructural protein. In addition, the fragment can comprise a portion of the carboxy terminus of the protein, amino terminus, or any portion therebetween. One skilled in the art can readily prepare immunogenic fragments of the HCV nonstructural proteins or fusion proteins containing immunogenic fragments of any combination of nonstructural proteins. Thus, it is contemplated that the recombinant nucleic acid molecule comprising a nucleotide coding sequence that encodes a HCV nonstructural protein may comprise less than the entire HCV nonstructural gene product without substantially altering the effectiveness of the vaccine. It is also contemplated that at least one nucleotide, as well as multiple, substitution may be made in the nucleotide coding sequence without affecting the amino acid sequence of the protein. It is also contemplated that at least one conservative amino acid substitution, as well as multiple substitutions, may be made throughout the protein without substantially reducing the immunogenic activity of the HCV nonstructural protein.

In some embodiments of the invention, the recombinant nucleic acid molecule comprises a fragment of the 5' UTR that includes the last 9 nucleotides of the HCV 5' UTR, the last 25 nucleotides of the HCV 5' UTR, the last 50 nucleotides of the HCV 5' UTR, the last 75 nucleotides of the HCV 5' UTR, the last 100 nucleotides of the HCV 5' UTR, the last 150 nucleotides of the HCV 5' UTR, the last 200 nucleotides of the HCV 5' UTR, the last 250 nucleotides of the HCV 5' UTR, or the last 300 nucleotides of the HCV 5' UTR. In some preferred embodiments, the gene construct includes the entire HCV 5' UTR. In some preferred embodiments, the gene construct includes the 9 most 3' nucleotides of the HCV 5' UTR. The entire HCV 5' UTR of a preferred embodiment is GCCAGCCCCC GATTGGGGGCGACACTCCACCATAGATCACTCCCCTGTGAGGAACTACTGTCT TCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAG CCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGT GAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTA GTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGA GTGCCCCGGGAGGTCTCGTAGACCGTGCACC (SEQ ID NO:2).

The regulatory elements necessary for gene expression of a DNA molecule include: a promoter, an initiation codon, a stop codon, and a polyadenylation signal. In addition, enhancers are often required for gene expression. It is necessary that these elements be operably linked to the sequence that encodes the HCV nonstructural protein and that the regulatory elements are operable in the individual to whom they are administered. Initiation codons and stop codon are generally considered to be part of a nucleotide sequence that encodes the HCV nonstructural protein.

Promoters and polyadenylation signals used must be functional within the cells of the individual. In order to maximize protein production, regulatory sequences may be selected which are well suited for gene expression in the cells the construct is administered into. Moreover, codons may be selected which are most efficiently transcribed in the cell. One having ordinary skill in the art can produce DNA constructs which are functional in the mammalian, preferably human, cells.

Examples of promoters useful to practice the present invention, especially in the production of a genetic vaccine for humans, include but are not limited to promoters from Simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus (HIV) such as the HIV Long Terminal Repeat (LTR) promoter, Moloney virus, ALV, Cytomegalovirus (CMV) such as the CMV immediate early promoter, Epstein Barr Virus (EBV), Rous Sarcoma Virus (RSV) as well as promoters from human genes such as human Actin, human Myosin, human Hemoglobin, human muscle creatine and human metalothionein.

Examples of polyadenylation signals useful to practice the present invention, especially in the production of a genetic vaccine for humans, include but are not limited to SV40 polyadenylation signals and LTR polyadenylation signals. In particular, the SV40 polyadenylation signal which is in pCEP4 plasmid (Invitrogen, San Diego Calif.), referred to as the SV40 polyadenylation signal, is used.

In addition to the regulatory elements required for gene expression, other elements may also be included in a gene construct. Such additional elements include enhancers. The enhancer may be selected from the group including but not limited to: human Actin, human Myosin, human Hemoglobin, human muscle creatine and viral enhancers such as those from CMV, RSV and EBV.

Gene constructs can be provided with mammalian origin of replication in order to maintain the construct extrachromosomally and produce multiple copies of the construct in the cell. Plasmids pCEP4 and pREP4 from Invitrogen (San Diego, Calif.) contain the Epstein Barr virus origin of replication and nuclear antigen EBNA-1 coding region which produces high copy episomal replication without integration.

Routes of administration include, but are not limited to, intramuscular, intrapentoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as transdermally or by inhalation or suppository. Preferred routes of administration include intramuscular, intraperitoneal, intradermal and subcutaneous injection. Delivery of gene constructs which encode HCV nonstructural protein can confer mucosal immunity in individuals immunized by a mode of administration in which the material is presented in tissues associated with mucosal immunity. Thus, in some examples, the gene construct is delivered by administration in the buccal cavity within the mouth of an individual.

Gene constructs may be administered by means including, but not limited to, traditional syringes, needleless injection devices, or "microprojectile bombardment gene guns". Alternatively, the genetic vaccine may be introduced by various means into cells that are removed from the individual. Such means include, for example, ex vivo transfection, electroporation, microinjection and microprojectile bombardment. After the gene construct is taken up by the cells, they are reimplanted into the individual. It is contemplated that otherwise non-immunogenic cells that have gene constructs incorporated therein can be implanted into the individual even if the vaccinated cells were originally taken from another individual.

According to some embodiments of the present invention, the gene construct is administered to an individual using a needleless injection device. According to some embodiments of the present invention, the gene construct is simultaneously administered to an individual intradermally, subcutaneously and intramuscularly using a needleless injection device. Needleless injection devices are well known and widely available. One having ordinary skill in the art can, following the teachings herein, use needleless injection devices to deliver genetic material to cells of an individual. Needleless injection devices are well suited to deliver genetic material to all tissue. They are particularly useful to deliver genetic material to skin and muscle cells. In some embodiments, a needleless injection device may be used to propel a liquid that contains DNA molecules toward the surface of the individual's skin. The liquid is propelled at a sufficient velocity such that upon impact with the skin the liquid penetrates the surface of the skin, permeates the skin and muscle tissue therebeneath. Thus, the genetic material is simultaneously administered intradermally, subcutaneously and intramuscularly. In some embodiments, a needleless injection device may be used to deliver genetic material to tissue of other organs in order to introduce a nucleic acid molecule to cells of that organ.

The genetic vaccines according to the present invention comprise about 1 nanogram to about 1000 micrograms of nucleic acid, preferably DNA. In some preferred embodiments, the vaccines contain about 10 nanograms to about 800 micrograms of nucleic acid. In some preferred embodiments, the vaccines contain about 0.1 to about 500 micrograms of nucleic acid. In some preferred embodiments, the vaccines contain about 1 to about 350 micrograms of nucleic acid. In some preferred embodiments, the vaccines contain about 25 to about 250 micrograms of nucleic acid. In some preferred embodiments, the vaccines contain about 100 micrograms nucleic acid. One skilled in the art can readily formulate a vaccine comprising any desired amount of nucleic acid.

The genetic vaccines according to the present invention are formulated according to the mode of administration to be used. One having ordinary skill in the art can readily formulate a pharmaceutical composition that comprises a gene construct. Pharmaceutical compositions of the present invention include single genetic constructs encoding either NS3, NS4, or NS5, or any combination thereof. Alternatively, pharmaceutical compositions of the present invention include multiple genetic constructs encoding either NS3, NS4, or NS5, or any combination thereof. In addition, pharmaceutical compositions of the present invention include single or multiple genetic constructs encoding a fragment of NS3, NS4, or NS5, or any combination thereof. In addition, pharmaceutical compositions of the present invention include a single genetic construct encoding fusion proteins of all or any fragment of NS3, NS4, or NS5 proteins. In some cases, an isotonic formulation is used. Generally, additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose. In some cases, isotonic solutions such as phosphate buffered saline are preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstriction agent is added to the formulation. The pharmaceutical preparations according to the present invention are provided sterile and pyrogen free.

The gene constructs of the invention may be formulated with or administered in conjunction with agents that increase uptake and/or expression of the gene construct, referred to herein as "facilitators," by the cells relative to uptake and/or expression of the gene construct by the cells that occurs when the identical genetic vaccine is administered in the absence of such agents. Such agents and the protocols for administering them in conjunction with gene constructs are described in U.S. Pat. Nos. 5,830,876, 5,593,972, 5,739,118 and PCT Patent Application Serial Number PCT/US94/00899 filed Jan. 26, 1994. Examples of such agents include: CaPO.sub.4, DEAE dextran, anionic lipids; extracellular matrix-active enzymes; saponins; lectins; estrogenic compounds and steroidal hormones; hydroxylated lower alkyls; dimethyl sulfoxide (DMSO); urea; and benzoic acid esters anilides, amidines, urethanes and the hydrochloride salts thereof such as those of the family of local anesthetics. In addition, the gene constructs are encapsulated within/administered in conjunction with lipids/polycationic complexes. A preferred facilitator is bupivicaine. The compositions can be conveniently administered in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical art, for example, as described in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, Pa., 1980), the disclosure of which is incorporated herein by reference in its entirety.

In the examples provided below, DNA-based vaccination with plasmids encoding for three different nonstructural proteins of HCV is shown to elicit strong antigen-specific immune responses in both arms of the immune system. After three immunizations, all animals developed detectable antibody responses. In this regard, these, nonstructural proteins are far better antigens to stimulate humoral immune responses compared to previous studies using the structural HCV core structural protein. Tokushige, et al., Hepatology, 1996, 24, 14 20; and Geissler, et al., J. Immunol., 1997, 158, 1231 1237. In preferred embodiments, the humoral immune response to the nonstructural proteins may be enhanced by addition of compounds which activate antigen presenting cells, such as, for example, cytokine expressing plasmids, such as IL-2 and GM-CSF. Geissler, et al., J. Immunol., 1997, 158, 1231 1237; and Xiang, Immunity, 1995, 129 135. Generation of inflammatory CD4+ T-cell responses with a predominant T.sub.Hl phenotype were demonstrated for all three plasmids encoding for NS3, NS4 and NS5. In addition, a strong and specific CD8+ CTL response was generated particularly for NS3 and NS5 with production of lysis values that have previously been shown to induce protection against a variety of pathogens in animal model systems. Tascon, et al., Nat. Med., 1996, 2, 888 892; and Huygen, et al., Nat. Med., 1996, 2, 893 898. Moreover, it was determined if CTL-responses generated by DNA based mutation would protect animals against tumor formation using syngeneic SP2/0 tumor cells stable transfected with a cDNA encoding for NS5 protein. Approximately 60% mice were protected against tumor formation thus indicating the high level CTL activity, produced in vivo by this immunization approach. Further, tumor weight in those animal who developed tumors was significantly reduced compared to notice immunized with mock DNA or recombinant NS5 protein. This model also demonstrates the capability of assessing high level cellular it immune responses against flaviviral nonstructural proteins in an animal model as measured inhibition of tumor growth.

The results disclosed herein teach that DNA-based immunization with gene constructs encoding HCV nonstructural proteins, as described herein, are useful for therapeutic treatment of individuals having HCV as well as for prophylactic vaccines against HCV.
 

Claim 1 of 13 Claims

1. A recombinant nucleic acid molecule consisting of a nucleotide sequence encoding hepatitis C virus nonstructural proteins NS3, NS4 and NS5, wherein said nucleotide sequence is operably linked to regulatory elements, said regulatory elements comprising a promoter, enhancer, polyadenylation sequence, and a hepatitis C virus 5' untranslated region (5'-UTR).

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.