Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells is administered to the subject. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin. bcl-xL in a subject or cell line can also be regulated by administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis.

SUMMARY OF THE INVENTION

The present application relates to the treatment of melanoma through reduction in the effective amount of clusterin. Thus, in accordance with one aspect of the invention, there is provided a method for treatment of melanoma in a mammalian subject, preferably a human, comprising the step of administering to the subject a therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin.

The present invention also provides a method for regulating expression of bcl-xL in a subject or cell line comprising administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis. See for example U.S. Pat. No. 6,172,216 which is incorporated herein by reference.

DESCRIPTION OF THE INVENTION

As used in the specification and claims of this application, the term "clusterin" refers to the glycoprotein originally derived from rat testes, and to homologous proteins derived from other mammalian species, including humans, whether denominated as clusterin or an alternative name. The sequences of numerous clusterin species are known. For example, the sequence of human clusterin is reported by Wong et al., Eur. J. Biochem. 221 (3), 917-925 (1994), and in NCBI sequence accession number NM.sub.--001831 and is set forth in the Sequence Listing as Seq. ID. No. 1. In this sequence, the coding sequence spans bases 48 to 1397.

The present invention provides a therapeutic composition, and methods for using such a composition for treatment of melanoma, particularly in humans. The therapeutic compositions and methods of the invention achieve a reduction in the effective amount of clusterin present in the individual being treated. As used in this application, the "effective amount of clusterin" is the amount of clusterin which is present in a form which is functional to provide anti-apoptotic protection. The effective amount of clusterin may be reduced by decreasing the expression rate of clusterin, increasing the rate of clusterin degradation, or by modifying clusterin (for example by binding with an antibody) such that it is rendered inactive.

Antisense ODN Therapeutics

In one embodiment of the invention, reduction in the effective amount of clusterin may be accomplished by the administration of antisense ODNs, particularly antisense ODNs which are complementary to a region of the clusterin mRNA spanning either the translation initiation site or the termination site. Exemplary sequences which can be employed as antisense molecules in the method of the invention are disclosed in PCT Patent Publication WO 00/49937, US Patent Publication US-2002-0128220-A1, and U.S. Pat. No. 6,383,808, all of which are incorporated herein by reference in those jurisdictions where such incorporation is permitted. Specific antisense sequences are set forth in the present application as Seq. ID Nos.: 2 to 12.

The ODNs employed may be modified to increase the stability of the ODN in vivo. For example, the ODNs may be employed as phosphorothioate derivatives (replacement of a non-bridging phosphoryl oxygen atoms with a sulfur atom) which have increased resistance to nuclease digestion. MOE (2'-O-(2-methoxyethyl) modification (ISIS backbone) is also effective. Construction of such modified ODN is described in detail in U.S. patent application Ser. No. 10/080,794 which is incorporated herein by reference in those jurisdictions permitting such incorporation. A particularly preferred composition is a 21mer oligonucleotide (cagcagcagagtcttcatcat; SEQ ID NO: 4) targeted to the translation initiation codon and next 6 codons of the human clusterin sequence (Genbank accession no: NM.sub.--001831) with a 2'-MOE modification. This oligonucleotide has a phosphorothioate backbone throughout. The sugar moieties of nucleotides 1-4 and 18-21 (the "wings") bear 2'-O-methoxyethyl modifications and the remaining nucleotides (nucleotides 5-17; the "deoxy gap") are 2'-deoxynucleotides. Cytosines in the wings (i.e., nucleotides 1, 4 and 19) are 5-methylcytosines.

Administration of antisense ODNs can be carried out using the various mechanisms known in the art, including naked administration and administration in pharmaceutically acceptable lipid carriers. For example, lipid carriers for antisense delivery are disclosed in U.S. Pat. Nos. 5,855,911 and 5,417,978 which are incorporated herein by reference. In general, the antisense is administered by intravenous, intraperitoneal, subcutaneous or oral routes, or direct local tumor injection.

The amount of antisense ODN administered is one effective to inhibit the expression of Clusterin in melanoma cells. It will be appreciated that this amount will vary both with the effectiveness of the antisense ODN employed, and with the nature of any carrier used. The determination of appropriate amounts for any given composition is within the skill in the art, through standard series of tests designed to assess appropriate therapeutic levels.

RNAi Therapeutics

Reduction in the effective amount of clusterin can also be achieved using RNAi therapy. RNA interference or "RNAi" is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression when it is introduced into worms (Fire et al. (1998) Nature 391, 806-811, incorporated herein by reference). dsRNA directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function. RNAi involves mRNA degradation, but many of the biochemical mechanisms underlying this interference are unknown. The use of RNAi has been further described in Carthew et al. (2001) Current Opinions in Cell Biology 13, 244-248, and Elbashir et al. (2001) Nature 411, 494-498, both of which are incorporated herein by reference.

In the present invention, isolated RNA molecules mediate RNAi. That is, the isolated RNA molecules of the present invention mediate degradation or block expression of mRNA that is the transcriptional product of the gene, which is also referred to as a target gene. For convenience, such mRNA may also be referred to herein as mRNA to be degraded. The terms RNA, RNA molecule(s), RNA segment(s) and RNA fragment(s) may be used interchangeably to refer to RNA that mediates RNA interference. These terms include double-stranded RNA, single-stranded RNA, isolated RNA (partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA), as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the RNA or internally (at one or more nucleotides of the RNA). Nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. Collectively, all such altered RNAi molecules are referred to as analogs or analogs of naturally-occurring RNA. RNA of the present invention need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi. As used herein the phrase "mediate RNAi" refers to and indicates the ability to distinguish which mRNA are to be affected by the RNAi machinery or process. RNA that mediates RNAi interacts with the RNAi machinery such that it directs the machinery to degrade particular mRNAs or to otherwise reduce the expression of the target protein. In one embodiment, the present invention relates to RNA molecules that direct cleavage of specific mRNA to which their sequence corresponds. It is not necessary that there be perfect correspondence of the sequences, but the correspondence must be sufficient to enable the RNA to direct RNAi inhibition by cleavage or blocking expression of the target mRNA.

As noted above, the RNA molecules of the present invention in general comprise an RNA portion and some additional portion, for example a deoxyribonucleotide portion. The total number of nucleotides in the RNA molecule is suitably less than 49 in order to be effective mediators of RNAi. In preferred RNA molecules, the number of nucleotides is 16 to 29, more preferably 18 to 23, and most preferably 21-23. Suitable sequences are set forth in the present application as Seq. ID Nos. 20 to 43.

The siRNA molecules of the invention are used in therapy to treat patients, including human patients, that have cancers or other diseases of a type where a therapeutic benefit is obtained by the inhibition of expression of the targeted protein. siRNA molecules of the invention are administered to patients by one or more daily injections (intravenous, subcutaneous or intrathecal) or by continuous intravenous or intrathecal administration for one or more treatment cycles to reach plasma and tissue concentrations suitable for the regulation of the targeted mRNA and protein.

Additional Therapeutic Agents

The method for treating melanoma in accordance with the invention may further include administration of chemotherapy agents or other agents useful in melanoma therapy and/or additional antisense ODNs directed at different targets in combination with the therapeutic effective to reduce the amount of active clusterin. For example, antisense clusterin ODN increases sensitivity to conventional chemotherapy agents as taxanes (paclitaxel or docetaxel), mitoxanthrone, and gemcitabine. Other agents likely to show synergistic activity include other cytotoxic agents (e.g. cyclophosphamide, decarbazine, topoisomerase inhibitors), angiogenesis inhibitors, differentiation agents and signal transduction inhibitors. Similarly, combinations of clusterin antisense with other antisense species such as antisense Bcl-2, Bcl-xl and c-myc ODN to provide greater effectiveness.

Method of Regulating Bcl-xL Expression

While chaperone-like function has been proposed for the clusterin protein, the specific molecular mechanism responsible for clusterin's role in apoptosis remains elusive. In the human melanoma cell line that expressed clusterin at a very low levels, over-expression of clusterin by stable transfection not only led to a marked increase in resistance to a cytotoxic treatment, but led also to an up-regulation of the anti-apoptotic bcl-2 family member bcl-xL as shown by Western blotting. Conversely treatment of clusterin-expressing melanoma cells led to a marked down-regulation of bcl-xL thus providing a possible mechanism for the antiapoptotic potency of clusterin. Neither clusterin overexpression by transfection nor clusterin antisense treatment altered the expression of other Bcl-2 family members tested in human melanoma cells. Thus, clusterin regulates the anti-apoptotic bcl-2 family member bcl-xL. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis (See U.S. Pat. No. 6,182,216 which is incorporated herein by reference in those jurisdictions permitting such incorporation).
 

Claim 1 of 12 Claims

1. A method for treatment of melanoma in a mammalian subject, comprising the step of administering to the subject a therapeutic agent effective to reduce the amount of clusterin in the melanoma cells, wherein the therapeutic agent is an oligonucleotide that targets clusterin and that has a sequence complementary to clusterin-encoding mRNA.
 

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.