Internet for Pharmaceutical and Biotech Communities
| Newsletter | Advertising |
 
 
 

  

Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 
   

 

  Pharmaceutical Patents  

 

Title:  Fused protein, gene therefor, recombinant vector, recombinant virus, and its use
United States Patent: 
7,348,422
Issued: 
March 25, 2008

Inventors: 
Saitoh; Shuji (Kawasaki, JP), Tsuzaki; Yoshinari (Kawasaki, JP), Yanagida; Noboru (Kawasaki, JP)
Assignee: 
Zeon Corporation (Tokyo, JP)
Appl. No.: 
09/147,052
Filed: 
March 28, 1997
PCT Filed: 
March 28, 1997
PCT No.: 
PCT/JP97/01084
371(c)(1),(2),(4) Date: 
April 05, 1999
PCT Pub. No.: 
WO97/36924
PCT Pub. Date:
 October 09, 1997


 

Training Courses -- Pharm/Biotech/etc.


Abstract

A DNA coding for a fusion protein comprising a polypeptide having the antigenicity of Mycoplasma gallisepticum and a polypeptide derived from Herpesvirus outer membrane protein, in which the polypeptide derived from the outer membrane protein has been ligated with the polypeptide having the antigenicity of Mycoplasma gallisepticum at the N terminus thereof, is prepared. The DNA is inserted into a region non-essential to growth of Avipox virus and the resulting recombinant Avipox virus is provided as a more potent recombinant virus as an anti-Mycoplasma vaccine.

Description of the Invention

DISCLOSURE OF THE INVENTION

Under the situation of the prior art stated above, the present inventors have made extensive studies to provide a recombinant virus capable of expressing a Mycoplasma antigenic protein having an enhanced infection prevention activity in large quantities, which allows a host to recognize the antigen highly efficiently. As a result, it has been found that by infecting to a host a recombinant Avipox virus, in which a hybrid DNA obtained by ligating a DNA of the outer membrane protein of the genus Herpesvirus with a DNA of the antigenic protein of Mycoplasma has been inserted, the antigen recognizing ability of the host can be markedly improved. The present invention has thus been accomplished.

Accordingly, the present invention provides:

a fusion protein comprising a polypeptide having the antigenicity of Mycoplasma gallisepticum (hereinafter sometimes referred to as Mycoplasma-derived polypeptide) and a polypeptide derived from the outer membrane protein of a herpes virus (hereinafter sometimes referred to as Herpesvirus-derived polypeptide) characterized in that the polypeptide derived from outer membrane protein is ligated with the polypeptide having the antigenicity of Mycoplasma gallisepticum at the N terminus thereof;

a hybrid DNA coding for the fusion protein;

a recombinant Avipox virus in which the hybrid DNA has been incorporated; and,

a live vaccine comprising the recombinant Avipox virus as an effective ingredient.

BEST MODE FOR PRACTICING THE INVENTION

Mycoplasma-derived Polypeptides and Genes Therefor

In the present invention, the term Mycoplasma-derived polypeptides is used to mean the antigenic proteins that cause an antigen-antibody reaction with MG immune serum or MG infected serum and that are derived from MG. These polypeptides are not restricted to proteins per se that native Mycoplasma gallisepticum expresses, and may include modified polypeptides. For example, one or more amino acids of the polypeptides may be modified naturally or artificially in a conventional manner such as site-specific mutation, etc. (JPB 6-16709, etc.) through loss, addition, insertion, deletion, substitution, etc. Of course, the proteins, even after such modification, should contain the epitope showing the antigenicity. For determination of the epitope region, there are available known methods based on the peptide scanning technique such as the method of Geysen et al. (J. Immunol. Meth., 102, 259-274 (1987)), the method of Hopp et al., (Proc. Natl. Acad. USA, 78, 3824-3828 (1981)), the method Chou et al. (Advances in Enzymology, 47, 145-148 (1987)), etc.

Specific examples of the peptides having the antigenicity include antigenic proteins disclosed in JPA 2-111795 (U.S. patent application Ser. Nos. 359,779, 07/888,320 and 08/299,662), JPA 5-824646 (U.S. Pat. No. 5,489,430), WO 94/23019 (U.S. patent application Ser. No. 08/525,742, JPA 6-521927) and proteins of Mycoplasma gallisepticum containing the amino acid sequences of those proteins. Of course, so long as the epitope is contained therein, a part of the peptides described above may also be usable.

Of these peptides, preferred are the polypeptide of about 40 killodaltons (kd) described in JPA 5-824646, the polypeptide of about 66 kd encoded by TM-66 gene and the polypeptide of about 67 kd encoded by TM-67 gene described in JPA 5-521927, which are designated as SEQ NO: 16 and SEQ NO: 27 therein.

In the present invention, genes of the Mycoplasma-derived polypeptides bear DNA sequences coding for the polypeptide having the antigenicity of Mycoplasma gallisepticum described above. Such DNA can be obtained by synthesis or acquired from wild bacteria belonging to Mycoplasma gallisepticum. Specific examples of such bacteria are strains R, S6, KP-13, PG31, etc. DNA may also be derived from MG isolated from wild strains. These genes can also be modified by loss, addition, insertion, deletion, substitution, etc. in a conventional manner as described in Methods in Enzymology, etc.

Herpesvirus-derived Polypeptides and Genes Thereof

The Herpesvirus-derived polypeptides in the present invention refer to polypeptides derived from proteins that construct an envelope of viruses belonging to the genus Herpesvirus. The Herpesvirus-derived polypeptides may not always be the full length of the proteins. Where the polypeptides are used solely to be expressed on the surface of cell membranes function as fusion proteins, it is sufficient for the polypeptide to contain a membrane anchor and a signal sequence therein, and where the polypeptides are employed for secretion, the polypeptides may contain only a signal sequence for that purpose. The outer membrane proteins may be either type I or type II of the outer membrane proteins. The signal sequence and the membrane anchoring sequence are both readily detectable by analyzing the amino acid sequence in the hydrophobic peptide region at the carboxyl terminus or amino terminus thereof.

Specific examples of the outer membrane protein include gB, gC, gD, gH and gI which are glycoproteins of herpes simplex viruses, and gBh, gCh, gDh, gHh and gIh of MDV corresponding to herpes simplex viruses glycoproteins gB, gC, gD, gH and gI, and proteins of the genus Herpesvirus homologous to the proteins described above.

Of course, polypeptides bearing the epitope other than the signal sequence of the outer membrane proteins may also be ligated with the aforesaid polypeptides having the antigenicity. By the ligation it is expected that the epitope will give the immunity to the living body in vivo.

In the present invention, the genes for the Mycoplasma-derived polypeptides contain DNA sequences coding for the Herpesvirus-derived polypeptides described above and such DNAs can be synthesized or acquired from naturally occurring herpes viruses. These genes may also be modified by loss, addition, insertion, deletion, substitution, etc. in a conventional manner as described in Methods in Enzymology, etc.

Fusion Protein and Hybrid DNA

The fusion proteins of the present invention are obtained by incubating a recombinant Avipox virus inserted hydrid DNA, which will be later described, in culture cells such as chick embryo fibroblast cells (hereinafter referred to as CEF cells) or embryonated chorioallantoic membrane cells, etc.

The thus obtained fusion proteins can be employed as a component vaccine.

The hybrid DNA of the present invention comprises the gene for the Mycoplasma-derived polypeptide and the gene for the Herpesvirus-derived polypeptide, which are ligated with each other directly or via an optional DNA sequence.

The hybrid DNA of the present invention can be produced in a conventional manner, for example, by a method in which the outer membrane protein and the antigenic protein of Mycoplasma gallisepticum are digested with restriction enzymes, respectively, and the resulting ligatable DNA fragment coding for the outer membrane protein of herpes viruses or for the signal sequence of the outer membrane protein is ligated with the resulting ligatable DNA fragment coding for the antigenic protein of Mycoplasma gallisepticum, using a ligase directly or via an appropriate linker.

Specific examples of the amino acid sequences for the fusion proteins of the present invention include SEQ ID NO: 2 and SEQ ID NO: 4. The sequence of the antigenic protein of 40 killodaltons derived from Mycoplasma gallisepticum is found in amino acids 64-456 of SEQ ID NO: 2 and in amino acids 693-1086 of SEQ ID NO: 4. The signal sequence of outer membrane protein gB derived from MDV is found in amino acids 1-63 of SEQ ID NO: 2. In SEQ ID NO: 4, amino acids 1-672 correspond to almost the full length of outer membrane protein gB derived from MDV. Specific examples of nucleotide sequences of the hybrid DNAs coding for these fusion proteins are those shown by SEQ ID NO: 1 and SEQ ID NO: 3.

These fusion proteins and hybrid DNAs are given by way of examples but are not deemed to be limited thereto.

Recombinant Avipox Virus

The recombinant Avipox virus of the present invention is a recombinant Avipox virus in which the aforesaid DNA or hybrid DNA has been inserted in the non-essential region. The recombinant Avipox virus of the present invention can be constructed in a conventional manner, e.g., by the method described in Japanese Patent Application Laid-Open No. 1-168279. That is, the non-essential region of Avipox virus is incorporated into a DNA fragment to construct a first recombinant vector.

As the non-essential region of Avipox virus which is used in the present invention, there are a TK gene region of quail pox virus, a TK region of turkey pox virus and DNA fragments described in JPA 1-168279, preferably a region which causes homologous recombination with EcoRI fragment of about 7.3 Kb, HindIII fragment of about 5.2 Kb, EcoRI-HindIII fragment of about 5.0 Kb, BamHI fragment of about 4.0 Kb, described in the patent specification supra.

Examples of the vector used in the present invention include plasmids such as pBR322, pBR325, pBR327, pBR328, pUC7, pUC8, pUC9, pUC18, pUC19, and the like; phages such as .lamda. phage, M13 phage, etc.; cosmid such as pHC79 and the like.

The Avipox virus used in the present invention is not particularly limited so long as it is a virus infected to avian. Specific examples of such a virus include pigeon pox virus, fowl pox virus (hereafter abbreviated as FPV), canary pox virus, turkey pox virus, preferably pigeon pox virus, FPV and turkey pox virus, more preferably pigeon pox virus and FPV. Specific examples of the most preferred Avipox virus include FPVs such as ATCC VR-251, ATCC VR-249, ATCC VR-250, ATCC VR-229, ATCC VR-288, Nishigahara strain, Shisui strain, CEVA strain and a viral strain among CEVA strain-derived viruses which forms a large plaque when infected to chick embryo fibroblast, and a virus such as NP strain (chick embryo-attenuated pigeon pox virus Nakano strain), etc. which is akin to FPV and used as a fowlpox live vaccine strain. These strains are commercially available and readily accessible.

Next, the hybrid DNA of the present invention is inserted into the non-essential region of the first recombinant vector described above to construct a second recombinant vector. In general, the hybrid DNA employed may have any nucleotide sequence, irrespective of synthetic or natural one, so long as the hybrid DNA effectively functions as a promoter in the system of transcription possessed by Avipox viruses. Accordingly, not only promoters inherent to Avipox viruses such as promoters for Avipox virus-derived genes coding for thymidine kinase but also DNAs derived from viruses other than Avipox viruses and DNAs derived from eukaryotes or prokaryotes may also be employed in the present invention, insofar as these substances meet the requirements described above. Specific examples of such promoters include promoters for vaccinia viruses (hereinafter often referred to as VV) as described in Journal of Virology, 51, 662-669 (1984), more specifically, a promoter of VV gene coding for 7.5 K polypeptide, a promoter of VV gene coding for 19 K polypeptide, a promoter of VV gene coding for 42 K polypeptide, a promoter of VV gene coding for thymidine kinase, a promoter of VV gene coding for 28 K polypeptide, etc. Furthermore, there may be used a synthetic promoter obtained by modification of the Moss et al. method (J. Mol. Biol., 210, 49-76 and 771-784, 1989), Davidson's synthetic promoter, a promoter obtained by modifying a part of the Davidson's promoter through deletion or change in such a range that the promoter activity is not lost (e.g., TTTTTTTTTTTTGGCATATAAATAATAATAAATACAATAATTAATTACGCGTAAAAA TTGAAAAACTATTCTAATTTATTGCACTC SEQ ID NO: 5, TTTTTTTTTTTTTTTTTTTTGGCATATAAATAATAAATACAATAATTAATTACGCGT AAAAATTGAAAAACTATTCTAATTTATTGCACTC SEQ ID NO. 6 etc.).

Further in view of easy detection of the recombinant virus, a marker gene such as a DNA coding for .beta.-galactosidase may also be inserted.

The recombinant Avipox virus can be constructed by transfecting the second recombinant vector described above to animal culture cells, which has been previously infected with Avipox virus, and causing homologous recombination between the vector DNA and the viral genome DNA. The animal culture cells used herein can be any cells, so long as Avipox can grow in the cells. Specific examples of such animal culture cells are CEF cells, embryonated egg chorioallantoic membrane cells, and the like.

The objective recombinant Avipox virus is isolated from the virus infected to host cells by plaque hybridization, etc.

Live Vaccine

The recombinant virus of the present invention constructed by the method described above can be inoculated to avian as a live vaccine for Mycoplasma gallisepticum infection.

The live vaccine of the present invention is prepared by, e.g., the following method, though the process is not particularly limited thereto. The recombinant virus of the present invention is infected to cells in which the virus can grow (hereafter referred to as host cells). After the recombinant virus grows, the cells are recovered and homogenated. The homogenate is centrifuged to separate into the precipitates and the high titer supernatant containing the recombinant virus. The resulting supernatant is substantially free of host cells but contains the cell culture medium and the recombinant virus and hence can be used as a live vaccine. The supernatant may be diluted by adding a pharmacologically inert carrier, e.g., physiological saline, etc. The supernatant may be freeze-dried to be provided for use as a live vaccine. A method for administration of the live vaccine of the present invention to fowl is not particularly limited and examples of the administration include a method for scratching the skin and inoculating the live vaccine on the scratch, effecting the inoculation through injection, oral administration by mixing the live vaccine with feed or drinking water, inhalation by aerosol or spray, etc. In order to use as the live vaccine, the dosage may be the same as ordinary live vaccine; for example, approximately 10.sup.2 to 10.sup.8 plaque forming unit (hereinafter abbreviated as PFU) is inoculated per chick. Where the inoculation is effected by injection, the recombinant virus of the present invention is generally suspended in about 0.1 ml of an isotonic solvent such as physiological saline and the resulting suspension is provided for use. The live vaccine of the present invention can be lyophilized under ordinary conditions and can be stored at room temperature. It is also possible to freeze the virus suspension at -20 to -70.degree. C. and store the frozen suspension.

Particularly where the genes coding for the polypeptides derived from the outer membrane proteins of herpes viruses described above are those coding for polypeptides having more than one epitope of herpes viruses, preferably having at least 90% homology to native outer membrane proteins, the live vaccine of the present invention functions as a vaccine for both Mycoplasma gallisepticum infection and Avipox viral infection. In addition, the live vaccine of the present invention can also function as an effective vaccine for infection with herpes virus originating from outer membrane proteins. That is, the live vaccine of the present invention can be used as a so-called trivalent vaccine.
 

Claim 1 of 6 Claims

1. A DNA molecule having a nucleotide sequence coding for a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.

 

 

     
[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]