The present disclosure relates to Birt-Hogg-Dube syndrome, nucleic acids encoding the BHD gene, and methods of using the nucleic acids and proteins encoded thereby. In particular, the present disclosure relates to methods of diagnosing BHD disease and related conditions, such as spontaneous pneumothorax and kidney cancer, and methods of treating BHD skin lesions.

Description of the Invention

SUMMARY OF THE DISCLOSURE

Disclosed herein is a BHD encoding sequence and methods of use, several specific mutant BHD encoding sequences, and the proteins (folliculins) encoded by these nucleic acid molecules. Also disclosed is a BHD consensus sequence. Specific embodiments are methods of diagnosing BHD disease and related conditions. Also provided are methods of treating BHD skin lesions.

In certain embodiments, the BHD encoding sequence is used in methods for the differential diagnosis of BHD disease, and in particular examples the BHD encoding sequence is used in a diagnostic test for BHD mutations performed using a blood sample. This test is particularly useful in detecting asymptomatic mutation carriers in BHD families.

Also disclosed are novel therapies for treatment of BHD skin lesions (fibrofolliculomas). For example, in certain embodiments the methods are methods of treating BHD skin lesions using a cream containing the BHD protein, folliculin. Such methods are expected to reduce the size and appearance of the benign hair follicle tumors. Further embodiments are methods of using the BHD encoding sequence in the differential diagnosis of sporadic kidney cancer. The BHD encoding sequence is the third gene found to be responsible for inherited kidney cancer, and mutation testing allows for diagnosis and initiation of the proper treatment, which is different for each of the types of kidney cancer caused by the three genes.

In some embodiments, the methods are methods of using the BHD encoding sequence in the differential diagnosis for spontaneous pneumothorax or collapsed lung. Collapsed lung can be caused by several factors, and a BHD diagnostic test allows a physician to determine if the emergency situation resulting from the subject's collapsed lung will recur, and whether the subject carries the predisposition to develop additional spontaneous pneumothoraces due to a BHD encoding sequence mutation.

DETAILED DESCRIPTION

Identification of a BHD Encoding Sequence

This disclosure provides BHD encoding sequences and proteins. These were identified by recombination mapping, which showed a disease-segregating insertion/deletion mutation within a previously uncharacterized gene. The full-length BHD cDNA sequence (SEQ ID NO: 1) was then isolated and sequenced from multiple cDNA libraries, and the predicted protein product (SEQ ID NO: 2) was based on computer-generated predictions. Methods of using these BHD encoding sequences and proteins are also provided herein.

Recombination mapping was used to narrow the minimal BHD region to 700 kb. Known candidate genes and uncharacterized mRNAs from within this 700 kb region were then screened for mutations in a panel of subjects who had been diagnosed with BHD. In five of nine BHD kindreds, a disease-cosegregating insertion/deletion mutation was identified in a mononucleotide (C).sub.8 tract within a previously uncharacterized gene (residues 1733-1740 of SEQ ID NO:1). This mutation produced a frameshift predicting a premature termination of the protein translation. An additional 22 of 53 BHD family probands were tested that were found to harbor the mononucleotide C tract insertion/deletion mutation, indicating that this sequence (residues 1733-1740 of SEQ ID NO:1) is a "hot spot" for expansion or contraction mutations in the BHD encoding sequence. Thus, other mutations are likely to be found in this region, in particular. In addition, several other germline BHD encoding sequence mutations were identified in the patient panel that resulted in frameshifts and predicted protein truncations. All of the mutations cosegregated with disease in BHD families, and none were present in 160 normal individuals tested for the mutations.

The full-length BHD cDNA sequence (SEQ ID NO: 1) was then isolated and sequenced from multiple cDNA libraries. Northern blot analysis revealed a 3.8 kb transcript expressed in most normal fetal and adult tissues, including lung, kidney and skin. The predicted 579 amino acid BHD protein (SEQ ID NO: 2), also referred to herein as folliculin, has a coiled-coil domain, three myristylation sites, and an N-glycosylation site, based on computer program-generated predictions. The protein sequence shows no homology to any known proteins. The identified mutant BHD mRNA sequences and encoded mutant folliculin proteins are shown in SEQ ID NOs: 3-12, and are described more fully below and in Table 2 (see Original Patent). A BHD consensus sequence is shown in SEQ ID NO: 42. One embodiment of the disclosure is a cell, for example a human cell, that has been transformed with a BHD nucleic acid sequence.

The discovery of germline BHD encoding sequence mutations responsible for the BHD syndrome makes possible the understanding of the biological role of the BHD protein, folliculin, in pathways common to skin, lung and kidney organogenesis, and to new treatments for BHD skin lesions and more effective therapies for renal cancer. In particular, mutations in the gene can be used in the differential diagnosis of BHD disease and in a DNA diagnostic test for BHD mutations, for instance using a blood sample. Such tests are particularly useful in detecting asymptomatic mutation carriers in BHD families.

Identification of the BHD encoding sequence also makes possible novel therapies for treatment of BHD skin lesions (fibrofolliculomas). For example, creams or other preparations containing the BID protein, folliculin, are proposed for use to reduce the size and appearance of the benign hair follicle tumors. Furthermore, the BHD encoding sequence is used in the differential diagnosis of sporadic kidney cancer; the BHD encoding sequence is the third gene found to be responsible for inherited kidney cancer, and mutation testing allows diagnosis and initiation of the proper treatment, which is different for each of the types of kidney cancer caused by the three genes.

Additionally, the BHD encoding sequence is used in the differential diagnosis for spontaneous pneumothorax or collapsed lung, as well as in diagnosing a propensity to develop spontaneous pneumothorax. Collapsed lung can be caused by several factors, and a BHD diagnostic test allows a physician to determine if the emergency situation resulting from the subject's collapsed lung is likely to recur, and whether the subject carries the predisposition to develop additional spontaneous pneumothoraces due to a BHD encoding sequence mutation. Furthermore, the BHD encoding sequence is used in the differential diagnosis for renal neoplasms and fibrofolliculomas, as well as in diagnosing a propensity to develop renal neoplasms and fibrofolliculomas.

Other embodiments are isolated nucleic acid sequences that hybridize with BHD nucleic acid sequence under low stringency, high stringency, or very high stringency conditions. A further embodiment is a pharmaceutical composition that includes a folliculin protein and a pharmaceutically acceptable carrier or diluent. The pharmaceutical composition is used, for example, in treating BHD disease.

Still other embodiments are single-stranded oligonucleotides that hybridize under highly stringent conditions to a nucleic acid molecule having the sequence of a mutant BHD sequence that encodes a truncated BHD protein associated with BHD disease, but that does not hybridize under highly stringent conditions to SEQ ID NO: 1. For example, in certain embodiments, the oligonucleotide hybridizes under highly stringent conditions to the mutant BHD sequence shown in SEQ ID NOs: 4, 6, 8, 10, or 12. In some embodiments, the oligonucleotide includes at least 10 consecutive nucleotides of the complements of SEQ ID NOs: 4, 6, 8, 10, or 12. In yet still another embodiment, the oligonucleotide is included in an array of nucleic acid molecules attached to a solid support. In particular embodiments, the oligonucleotide recognizes one or more of the following mutations: a) deletion of the guanosine of position 1088 of SEQ ID NO: 1, b) insertion of the nucleic acid sequence GTGTTGCCAGAGAGTACAGAAAGCCCCT at position 1389 of SEQ ID NO: 1, c) insertion of a cytosine at position 1741 of SEQ ID NO: 1, d) deletion of the cytosine at position 1740 of SEQ ID NO: 1, or e) substitution of a cytosine for the guanine at position 1844 of SEQ ID NO: 1.

Yet still another embodiment is an antisense oligonucleotide that inhibits the expression of the BHD protein encoded by SEQ ID NO. 1. Further embodiments are methods that include obtaining a sample of nucleic acid from a subject, and determining an identity of a nucleotide that results in truncation of the BHD protein. In certain examples, the determining step includes amplifying at least a portion of a nucleic acid molecule comprising the BHD gene. In certain other examples the determining step includes sequencing at least a portion of a nucleic acid molecule comprising the BHD gene. In still other examples, the method includes determining a propensity to develop a condition associated with BHD disease, and in particular examples, the condition includes fibrofolliculoma, renal neoplasia, or spontaneous pneumothorax.

Other embodiments include a purified polypeptide having an amino acid sequence that includes the sequence as set forth in SEQ ID NO: 2 or sequences having at least 95% sequence identity to SEQ ID NO: 2. In certain examples, sequence has at least 98% sequence identity to SEQ ID NO: 2. Also disclosed is a nucleic acid that encodes the polypeptide of claim 53. In particular examples, the purified polypeptide of claim 53 includes SEQ ID NO: 2 with 0 to 10 conservative amino acid substitutions.

Still other embodiments are purified polypeptides that bind specifically to an antibody that binds specifically to BHD protein. Some examples include a purified antibody that selectively binds to an epitope of a BHD protein. In some examples, the epitope is a region on the BHD protein that is truncated in BHD disease. In particular examples, the epitope is within amino acid residues 479 to 579 of SEQ ID NO: 2, and in certain examples the antibody binds specifically to a mutant form of BHD but not to a normal form of BHD.
 

Claim 1 of 18 Claims

1. An isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11.

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.