Internet for Pharmaceutical and Biotech Communities
| Newsletter | Advertising |
 
 
 

  

Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 
   

 

  Pharmaceutical Patents  

 

Title:  Gut commensal bacterium and methods of using the same
United States Patent: 
7,988,961
Issued: 
August 2, 2011

Inventors:
 Farrar; Mark (Leeds, GB), Carding; Simon (Leeds, GB)
Assignee:
  Plant Bioscience Limited (GB)
Appl. No.:
 11/814,739
Filed:
 January 24, 2006
PCT Filed:
 January 24, 2006
PCT No.:
 PCT/GB2006/000222
371(c)(1),(2),(4) Date:
 July 25, 2007
PCT Pub. No.:
 WO2006/079790
PCT Pub. Date:
 August 03, 2006


 

Executive MBA in Pharmaceutical Management, U. Colorado


Abstract

The invention provides gut commensal bacteria that have been modified to express one or more biologically active polypeptides or protiens, the bacteria includes a promoter, such as a xylanase promoter, which is induced in response to the presence of xylan in the diet and which regulates the expression of the biologically active polypeptide or protien.

Description of the Invention

BRIEF SUMMARY OF THE DISCLOSURE

According to a first aspect of the invention there is provided a gut commensal bacterium deposited under the provisions of the Budapest Treaty at the National Collection of Industrial, Food and Marine Bacteria (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, Scotland AB21 9YA on Nov. 29, 2007 and assigned Accession No. 41521 (Bacteriodes ovatus BO-KGF), 41522 (Bacteriodes ovatus BO-TGF) or 41523 (Bacteriodes ovatus BO-MUIL2-S) modified to express one or more biologically active polypeptides or proteins, the bacterium further comprising a promoter which is induced in response to the presence of a dietary factor and which regulates the expression of said biologically active polypeptide or protein.

Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

An operon may be defined as a functional unit consisting of a promoter, an operator and a number of structural genes. An example is the xylanase operon. The structural genes commonly code for several functionally related enzymes, and although they are transcribed as one (polycistronic) mRNA, each has its separate translation initiation site. In the typical operon, the operator region acts as a controlling element in switching on or off the synthesis of mRNA. The xylanase operon is activated in the presence of xylan.

Preferably, the promoter is constitutive and more preferably is the xylanase promoter. Thus it will be appreciated that the expression of the one or more biologically active polypeptides or protiens is controlled by the presence of xylan in the diet. The bacteria can therefore be said to comprise a xylan-inducible regulatory element.

Xylan is a water-soluble, gummy polysaccharide found in plant cell walls and yielding xylose upon hydrolysis. It is therefore a common dietary factor or component, accordingly the inclusion or exclusion of xylan in the diet controls the expression of the biologically active polypeptide or protien. The modified bacteria of the present invention therefore advantageously provide an easily controllable expression system avoiding repeated invasive dosing of an individual since the modified bacteria of the present invention are also able to colonise the gut whilst concomitantly minimising any adverse side-effects.

Preferably, the bacterium is obligate anaerobe and more preferably still said bacterium is either Bacteroides ovatus or Prevotella.

Preferably, the bacterium in non-pathogenic to man.

"Biologically active" refers to the ability to perform a biological function. The biologically active polypeptide or protein used in the present invention can be either homologous to the bacterium or heterologous thereto, derived from either eukaryotic or prokaryotic or viral sources.

Specific examples of such polypeptides and proteins used in the present invention preferably include insulin, growth hormone, prolactin, calcitonin, luteinising hormone, parathyroid hormone, somatostatin, thyroid stimulating hormone, vasoactive intestinal polypeptide, trefoil factors, cell and tissue repair factors, transforming growth factor .beta., keratinocyte growth factor, a structural group 1 cytokine adopting an antiparallel 4.alpha. helical bundle structure such as IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12, IL-13, GM-CSF, M-CSF, SCF, IFN-.gamma., EPO, G-CSF, LIF, OSM, CNTF, GH, PRL or IFN.alpha./.beta., a structural group 2 cytokine which are often cell-surface associated, form symmetric homotrimers and the subunits take up the conformation of .beta.-jelly roll described for certain viral coat proteins such as the TNF family of cytokines, eg TNF.alpha., TNF.beta., CD40, CD27 or FAS ligands, the IL-1 family of cytokines, the fibroblast growth factor family, the platelet derived growth factors, transforming growth factor p and nerve growth factors, a structural group 3 cytokine comprising short chain .alpha./.beta. molecules, which are produced as large transmembrane pre-cursor molecules which each contain at least one EGF domain in the extracellular region, eg the epidermal growth factor family of cytokines, the chemokines characterised by their possession of amino acid sequences grouped around conserved cysteine residues (the C-C or C-X-C chemokine subgroups) or the insulin related cytokines, a structural group 4 cytokine which exhibit mosaic structures such as the heregulins or neuregulins composed of different domains, eg EGF, immunoglobulin-like and kringle domains.

Alternatively, the biologically active polypeptide can be a receptor or antagonist for biologically active polypeptides as defined above.

The bacterium expresses the biologically active polypeptide or protein and the antigen from nucleic acid contained within it. The nucleic acid may comprise one or more nucleic acid constructs in which nucleic acid encoding the biologically active polypeptide and nucleic acid encoding the antigen are under control of appropriate regulatory sequences for expression in the bacterium.

The bacterium may also express the biologically active polypeptide or protein as a vaccine.

Preferably, the bacterium of the present invention may be modified to express a plurality of biologically active polypeptides or proteins.

According to a further aspect of the invention there is provided a pharmaceutical comprising a gut commensal bacterium modified to express one or more biologically active polypeptides or protiens, the bacterium further comprising a promoter which is induced in response to the presence of a dietry factor and which regulates the expression of said biologically active polypeptide or protien.

Preferably, the pharmaceutical is provided as a composition in a physiologically acceptable carrier, diluent or excipient.

Preferably, the pharmaceutical comprises any one or more of the features hereinbefore recited.

According to a further aspect of the invention there is provided use of a gut commensal bacterium modified to express one or more biologically active polypeptides or protiens, the bacterium further comprising a promoter which is induced in response to the presence of a dietry factor and which regulates the expression of said biologically active polypeptide or protien, in the manufacture of a medicament for the treatment of chronic infammatory bowel disease.

Preferably, the use further comprises any one or more of the features hereinbefore recited.

According to a further aspect of the invention there is provided a method of delivering one or more biologically active polypeptides or proteins or antigens or enzymes or vaccine which comprises administering to a subject a gut commensal bacterium which expresses one or more of said biologically active agents expression of which is under control of a promoter which is activated in the presence of a dietry factor.

Preferably, bacterium expresses more than one biologically active polypeptide or protein or antigen or enzyme or vaccine or a combination thereof.

Preferably, the method comprises the administration of a mixture of bacteria expressing a variety of biologically active polypeptides or proteins or antigens or enzymes or vaccines or a combination thereof.

Thus it will be appreciated that in this embodiment of the invention there is provided, for example and without limitation, bacteria capable of expressing IL2 and bacteria capable of expressing IL12 and/or IL9 and optionally bacteria capable of expressing a cell and tissue repair factor.

Preferably, the method includes any one or more of the features herein before described.

Bacteroides ovatus, is a major commensal colonic Gram-negative bacterium in humans and rodents for which cloning systems are available that allow the introduction of foreign DNA into the organism and integration into the genome (Tancula et al. 1992). This organism is also one of only a few that are able to degrade the polysaccharide xylan. We provide evidence for the successful engineering of B. ovatus to produce murine IL2 (MuIL2) intracellularly under the control of the xylanase promotor which is active in the presence of xylan. Our results demonstrate that B. ovatus can be induced to produce biologically active MuIL2 in response to xylan. We have also engineered a second strain to secrete MuIL2 by adding the B. fragilis enterotoxin secretion signal sequence to the protein. The recombinant strains produced MuIL2 only in the presence of xylan as determined by enzyme-linked immunosorbent assay of cell lysates and culture supernatants. The IL2-dependent cell line CTLL-2 was used to demonstrate that MuIL2 produced by both B. ovatus strains was biologically active. Moreover, this activity could be blocked by an anti-IL2 neutralising antibody.

According to a further aspect of the invention there is provided a method of treating chronic inflammation of the gut comprising administering to an individual suffering from such a condition a pharmaceutically effective amount of a gut commensal bacterium modified to express one or more biologically active polypeptides or protiens, the bacterium further comprising a promoter which is induced in response to the presence of a dietry factor and which regulates the expression of said biologically active polypeptide or protien.

The use of bacteria of the invention as drug delivery vehicles offers a means of delivering immunomodulatory factors, such as cytokines, and other biologically active molecules directly to the site action to treat chronic inflammation of the gut.

The advantages of this unique form of therapeutic delivery is that it is a convenient and simple means of delivering biologically active proteins directly to their site of action, avoiding the inconvenience and systemic exposure associated with parenteral therapy

DETAILED DESCRIPTION

Bacterial Strains, Plasmids and General DNA Manipulations

E coli DH5.alpha. and J53/R751 were grown in LB medium. Cultures of E. coi J53/R751 were supplemented with 200 .mu.g trimethoprim ml.sup.-1. B. ovatus V975 was grown anaerobically at 37.degree. C. in brain heart infusion (BHI) broth supplemented with 10 .mu.g haemin ml.sup.-1 or in routine growth medium (RGM) prepared as described by Hespell et al. (1987) and supplemented with 0.1% (w/v) glucose. Where xylan was required, a hot water-soluble fraction of oatspelt xylan was prepared by the method of Hespell and O'Bryan (1992) and added to media at a concentration of 0.2% (w/v). Transfer of plasmids to B. ovatus from E. coli J53/R751 was carried out by conjugation as described by Valentine et al. (1992). pBT2 (Tancula et al. 1992) was selected in E. coli using 50 .mu.g kanamycin ml.sup.-1. B. ovatus transconjugants were selected on BHI-haemin agar containing 200 .mu.g gentamicin ml.sup.-1 and 5 .mu.g tetracycline ml.sup.-1. Transconjugants were subsequently grown in medium containing 1 .mu.g tetracycline ml.sup.-1. E. coli was transformed by the method of Hanahan (1983). General DNA manipulations were carried out as described by Sambrook et al. (1990).

Construction of MuIL2-producing and control B. ovatus strains

MuIL2-producing strain BOMuIL2. The MuIL2 gene was PCR-amplified from cDNA cloned in pUC13 using primers MuIL2F1 (GCGCATATGGCACCCACTTC MGCTCCAC;SEQ ID NO:1 Ndel site in bold) and MuIL2R1 (GCGGGATCCTT ATTGAGGGCTTGTTGAGATGATG; SEQ ID NO:2 BamH1 site in bold). A portion of the B. ovatus xylanase operon encompassing the 3' half of the orf gene and region between this gene and the xyl gene was amplified from plasmid pOX1 (Whitehead and Hespell 1990) using primers ORFF1 (GCGGGATCCATGGAGCA TGAATGCGTCA; SEQ ID NO:3 BamHI site in bold) and ORFR1 (CATATGTTA TATTTTTGAGTMTAAACATTCTAC; SEQ ID NO:4 Ndel site in bold). The MuIL2 and ORF PCR products were cloned into pGEM-T (Promega) to create plasmids pGEM-MuIL2 and pGEM-ORF respectively. MuIL2 was removed from pGEM-MuIL2 with Ndel and ligated into Ndel-digested PGEM-ORF to create pORF-MuIL2. The insert was sequenced to verify the construct. The ORF-MuIL2 construct was removed from pORF-MuIL2 by BamHI digestion and cloned into the BamHI site of pBT2 to create pBOMuIL2. This plasmid was transferred into B. ovatus by conjugation and integration of the plasmid into the genome of transconjugants was confirmed by PCR. MUIL2-secreting strain BOMuIL2-S. B. ovatus strain BOMuIL2-S was constructed in the same way as strain BOMuIL2 except that the MuIL2 gene was PCR-amplified using primers BFTSIGIL2F (GACATATGMGAATGTAAAGTTACTTTTAA TGCTAGGAACCGCGGCATTATTAGCTGCAGCACCCACTTCAAGCTCCAC; SEQ ID NO:5 signal sequence coding region is underlined, Ndel site in bold) and MuIL2R1. This led to the creation of plasmids pGEM-MuIL2-S, pORF-MuIL2-S and pBOMulL2-S.

Control strain BT2. The control strain containing pBT2 without the MuIL2 gene was constructed as follows. The same portion of the off gene as used above was PCR amplified with primers ORFF1 and ORFR2 (GGATCCTTATATTTTTGAGTAAT AAACATTCTAC; SEQ ID NO:6 BamHI site in bold) and cloned into pGEM-T to create pGEM-ORFB. The insert was removed with BamHI and cloned into the BamHI site of pBT2 to create pBT-ORF. This plasmid was transferred into B. ovatus as described above.

Preparation of Samples of B. ovatus producing MuIL2.

B. ovatus strains V975, BT2, BOMuIL2 and BOMuIL2-S were grown in 10 ml RGM with or without xylan for 24 h. Strains BOMuIL2 and BOMuIL2-S were also grown for 16 h without xylan and then with xylan for a further 8 h. Following incubation, cells were harvested (5000 g, 30 min, 4.degree. C.). Supernatants were removed and frozen. Cells were washed once in 10 ml RGM and resuspended in 5 ml distilled water. Cells were disrupted by sonication on ice for 4.times.20 sec at 12 .mu.m (Soniprep 150, MSE). Unbroken cells and cell debris were removed by centrifugation (13,000 g, 20 min, 4.degree. C.). Lysates and supernatants were lyophilized and resuspended in 0.5 ml distilled water.

Assays for Detection of MuIL2

An ELISA incorporating native rat anti-mouse IL2 (clone JES6-1A12) and biotinylated rat anti-mouse IL2 (clone JES65H4) as capture and detection antibodies respectively, was used to quantify levels of MuIL2 produced by recombinant strains of B. ovatus and was carried out according to manufacturer's instructions (BD Pharmingen). Recombinant MuIL2 (rMulL2; Sigma) was used as a control to obtain a standard curve. An IL2 bioassay using the indicator cell line CTLL-2 (Gillis et al. 1978) was used to detect the presence of biologically active MuIL2 in samples (Wadhwa et al. 2000). Briefly, cells were incubated with dilutions of test samples or control rMuIL2 in 96-well plates in duplicate for 18 h. Cells were then pulsed with 0.5 .mu.Ci [.sup.3H]thymidine, harvested after 4 h and the radioactivity incorporated into DNA estimated by scintillation counting. The assay was also performed in the presence of an IL2 neutralising antibody (clone JES6-1A12). This was added to samples at a concentration of 5 .mu.g ml.sup.-1 1 h before addition of cells.

Detection of MuIL2 transcription by RT-PCR

B. ovatus V975, BT2, BOMuIL2 and BOMuIL2-S were grown in RGM without xylan for 16 h. A preinduction sample was taken from cultures of BOMuIL2 and BOMuIL2-S before xylan was added to induce transcription of the xylanase operon. Samples were taken from all four cultures after 1 h. Total RNA was extracted from cell samples using the RNeasy kit (Qiagen) followed by treatment with TURBO DNA-free.TM. (Ambion) to remove any residual contaminating DNA. RT-PCR was performed using the AccessQuick.TM. RT-PCR System (Promega) and primers for the orf-Muil2 fusion (CCGATGGTACCTGCCATTAAA (SEQ ID NO:7) and CTGTGCTTCCGCTGAGG) SEQ ID NO:8 or the gyrA gene (CTCCATGTCGG TCATCGTTTC (SEQ ID NO:9) and CAAAGGATMCGCATTGCCCA (SEQ ID NO:10)) as a positive control. As a negative control the reaction was performed without the addition of reverse transcriptase.

Construction of B. ovatus strains

In order to construct a strain of B. ovatus capable of expressing MuIL2 in a xylan-inducible manner, the MuIL2 gene (minus native signal sequence) and 3' portion of the orf gene of the xylanase operon were PCR-amplified and ligated in pGEM-T to give plasmid pORF-MuIL2. An ATG start codon was positioned before the sequence encoding the mature MuIL2 as part of an Ndel site. This ensured translation of the protein. The use of this Ndel site for cloning resulted in a single base change (G to A) in the non-coding region between off and the MuIL2 gene compared to the wild-type region between off and xyl. However, this was not expected to affect MuIL2 expression. The construction of plasmid pBOMuIL2 in FIG. 1 (see Original Patent) comprises the 3' portion of the B. ovatus off gene and entire MuIL2 gene amplified by PCR, ligated together in pBluescript then subcloned into pBT2 to create pBOMuIL2. Only restriction sites used for cloning are shown in the Figure. tet, tetracycline resistance for selection in B. ovatus; kan, kanamycin resistance for selection in E. coli; oriV, origin of replication; repA, repB, repC encode replication functions and mob is required for mobilization from E. coli to B. ovatus. The pBOMuIL2 plasmid (FIG. 1) was then successfully transferred to B. ovatus V975. The MuIL2-secreting strain, B. ovatus BOMuIL2-S, was constructed in the same way except that the forward primer used to PCR-amplify the MuIL2 gene, contained the sequence coding for the B. fragilis enterotoxin secretion signal sequence. A control strain, B. ovatus BT2 was also constructed by cloning only the off gene into pBT2. Successful construction of the MuIL2 and MulL2-S expression strains, and BT2 control strain was confirmed by PCR and nucleotide sequencing (data not shown).
 

Claim 1 of 12 Claims

1. A recombinant Bacteroides ovatus gut commensal bacterium deposited at the National Collection of Industrial, Food and Marine Bacteria (NCIMB) Accession No. 41521, 41522 or 41523 wherein the bacterium comprises a xylanase promoter that regulates expression of a polypeptide or protein and wherein the promoter is induced in the presence of dietary xylan.
 

 

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.
 

 

     
[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]