Internet for Pharmaceutical and Biotech Communities
| Newsletter | Advertising |
 
 
 

  

Pharm/Biotech
Resources

Outsourcing Guide

Cont. Education

Software/Reports

Training Courses

Web Seminars

Jobs

Buyer's Guide

Home Page

Pharm Patents /
Licensing

Pharm News

Federal Register

Pharm Stocks

FDA Links

FDA Warning Letters

FDA Doc/cGMP

Pharm/Biotech Events

Consultants

Advertiser Info

Newsletter Subscription

Web Links

Suggestions

Site Map
 

 
   

 

  Pharmaceutical Patents  

 

Title:  Methods for determining human immunodeficiency virus type 2 (HIV-2) protease sensitivity or resistance to antivirals utilizing an inducible yeast expression system
United States Patent: 
7,989,161
Issued: 
August 2, 2011

Inventors:
 Gluschankof; Pablo (Marseilles, FR), Raoult; Didier (Marseilles, FR), Ben M'Barek; Najoua (Marseilles, FR), Audoly; Gilles (Marseilles, FR)
Assignee:
  Universite de la Mediterranee (FR), Centre National de la Recherche Scientifique - CNRS (FR)
Appl. No.:
 11/628,120
Filed:
 June 2, 2005
PCT Filed:
 June 02, 2005
PCT No.:
 PCT/FR2005/001356
371(c)(1),(2),(4) Date:
 December 21, 2006
PCT Pub. No.:
 WO2006/000693
PCT Pub. Date:
 January 05, 2006


 

Outsourcing Guide


Abstract

A method for determining sensitivity or resistance of isolates of HIV (human immunodeficiency virus) retroviruses to chemical molecules having an inhibiting activity on a viral protease or to therapeutic treatments based on inhibitors of the viral protease, including causing cell lysis of at least one yeast by expression of the retrovirus protease.

Description of the Invention

RELATED APPLICATION

This is a .sctn.371 of International Application No. PCT/FR2005/001356, with an international filing date of Jun. 2, 2005 (WO 2006/000693 A1, published Jan. 5, 2006), which is based on French Patent Application No. 04/05945, filed Jun. 2, 2004.

TECHNICAL FIELD

This disclosure relates to methods for determining the sensitivity or resistance of retroviruses such as HIV to therapeutic treatments based on viral protease inhibitors, by the use of yeast, particularly to the use of yeast for determining the resistance or sensitivity of the viral protease to the chemical molecules used in the context of therapeutic protocols. The disclosure also relates to diagnostic kits comprising the elements for implementing the method.

BACKGROUND

The aetiological agents of AIDS are the human immunodeficiency viruses types 1 and 2. These viruses, which share certain clinical and biological characteristics, have major differences, in particular with regard to the ways in which the host is infected. Infection by HIV-2 is more difficult than by HIV-1 (Ancelle R, O Bletry, A C Baglin, F Brun-Vezinet, M A Rey and P Godeau, 1987, Long incubation period for HIV-2 infection. Lancet. 1:688-9; Marlink R, P Kandki, I Thior, K Travers, G Eisen, T Siby, I Traore, C C Hsieh, M C Dia and E H Gueye. 1994. Reduced rate of disease development after HIV-2 infection as compared to HIV-1. Science. 265:1587-90; Adjorlolo-Johnson G, K M De Cock, E Ekpini, K M Vetter, T Sibailly, K Brattegaard, D Yavo, R Doorly, J P Whitaker and L Kestens. 1994. Prospective comparison of mother-to-child transmission of HIV-1 and HIV-2 in Abidjan, Ivory Coast. JAMA. 272:462-6; Marlink, R. 1996. Lessons from the second AIDS virus, HIV-2. AIDS. 10:689-99.), the plasma viral load of individuals infected by HIV-2 is less high than that in individuals infected by HIV-1 (Andersson S, H Norrgren, Z da Silva, A Biague, S Bamba, S Kwok, C Christopherson, G Biberfeld, and J Albert. 2000. Plasma viral load in HIV-1 and HIV-2 singly and dually infected individuals in Guinea-Bissau, West Africa: significantly lower plasma virus set point in HIV-2 infection than in HIV-1 infection. Arch. Intern. Med. 160:3286-93; Popper S J, A D Sarr, K U Travers, A Gueye-Ndiaye, S Mboup, M E Essex, and P J Kanki. 1999. Lower human immunodeficiency virus (HIV) type 2 viral load reflects the difference in pathogenicity of HIV-1 and HIV-2. J Infect Dis. 180:1116-21.), and the individuals infected by HIV-2 develop the illness more slowly (Vittinghoff E, S Scheer, P O'Malley, G Colfax, S D Holmberg and S P Buchbinder. 1999. Combination antiretroviral therapy and recent declines in AIDS incidence and mortality. J Infect Dis. 179:717-20; Blanco R, Carrasco, L, and Ventoso, I. 2003. Cell killing by HIV-1 protease. J. Biol. Chem. 278:1086-93; Liu H, Krizek J, and Bretscher A. 1992. Construction of a GAL1-regulated yeast cDNA expression library and its application to the identification of genes whose overexpression causes lethality in yeast. Genetics 132:665-673).

HIV-2 was identified for the first time in West Africa in 1986 (Clavel F, D Guetard, F Brun-Vezinet, S Chamaret, M A Rey, M O Santos-Ferreira, A G Laurent, C Dauguet, C Katlama, and C Rouzioux. 1986. Isolation of a new human retrovirus from West African patients with AIDS. Science. 233:343-6). In this region, the prevalence of HIV-2 varies between 1% and 10% (Langley C L, E Benga-De, C W Critchlow, I Ndoye, M D Mbengue-Ly, J Kuypers, G Woto-Gaye, S Mboup, C Bergeron, K K Holmes, and N B Kiviat. 1996. HIV-1, HIV-2, human papillomavirus infection and cervical neoplasia in high-risk African women. AIDS. 10:413-7, Poulsen A G, B Kvinesdal, P Aaby, K Molbak, K Frederiksen, F Dias and E Lauritzen. 1989. Prevalence of and mortality from human immunodeficiency virus type 2 in Bissau, West Africa. Lancet. 1:827-31; Wilkins A, D Ricard, J Todd, H Whittle, F Dias, and A Paulo Da Silva. 1993. The epidemiology of HIV infection in a rural area of Guinea-Bissau. AIDS. 7:1119-22). The majority of these cases of infection by HIV-2, outside West Africa, are found in European countries and especially in Portugal where the individuals infected by VIH-2 represent 13% of the population infected by human immunodeficiency viruses (Soriano V, P Gomes, W Heneine, A Holguin, M Doruana, R Antunes, K Mansinho, W M Switzer, C Araujo, V Shanmugam, H Lourenco, J Gonzalez-Lahoz and F Antunes. 2000. Human immunodeficiency virus type 2 (HIV-2) in Portugal: clinical spectrum, circulating subtypes, virus isolation, and plasma viral load. J Med. Virol. 61:111-6). In France it has been estimated that 1% of the population infected by HIV is infected by the type 2 virus.

In developed countries, the individuals infected by HIV-1 and/or by HIV-2 are treated by chemical therapy, composed of molecules having an inhibiting activity for one or other of the two viral enzymes: Reverse Transcriptase and Protease.

Although this treatment has significantly helped to reduce morbidity and mortality caused by HIV infection (Palella F J, Jr, K M Delaney, A C Moorman, M O Loveless, J Fuhrer, G A Satten, D J Aschman and S D Holmberg. 1998. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. HIV Outpatient Study Investigators. N. Engl. J. Med. 338:853-60; Vittinghoff E, S Scheer, P O'Malley, G Colfax, S D Holmberg and S P Buchbinder. 1999. Combination antiretroviral therapy and recent declines in AIDs incidence and mortality. J. Infect. Dis. 179:717-20), some cases of therapeutic failure have been observed.

The possibility of amplifying, from the plasma RNA or cell DNA of the individuals infected by HIV-1 and in therapeutic failure, has made it possible to understand at the molecular level the spontaneous or progressive inefficacy of therapeutic treatments. The determination in particular of the nucleic sequence of the two viral enzymes Reverse Transcriptase and Protease has shown the appearance of a certain number of mutations. The results obtained during studies in vitro, in which a wild viral strain (and therefore sensitive to treatments) carried the said mutations, have clearly demonstrated the implication of these mutations in the resistance of the virus to treatment.

Researchers have therefore done a certain amount of work on these mutations and on the resistances that they generate, in order to orient and guide the choice of therapeutic treatment and to optimize its efficacy.

Unfortunately, the economic strategies of the laboratories have the majority of the time led to a general lack of interest in the scientific community with regard to the treatment of patients infected by HIV-2 (the populations most affected by HIV-2 being mainly those in developing countries) or have led to unsuitable solutions: treatments, tests and analyses that are too expensive, diagnoses that are too lengthy or impossible to implement on site, absence of competent structures in the country concerned, etc.

Thus the results obtained during the various studies carried out on HIV-2 have not been sufficiently consistent to make it possible to formulate a correlation between a particular mutation of the HIV-2 protease, and a resistance phenotype.

In addition, the progression of the illness being slower in individuals infected by HIV-2 than in those infected by HIV-1, the counting of T CD4 cells and the determination of the plasma viral load do not rapidly take account of the emergence of resistant strains in patients under treatment.

There exist at the present time three companies that provide the resistance profile of an HIV strain isolated from an infected patient. Conceptionally the three tests resemble each other and are based on the ability of each protease inhibitor to inhibit the release of an infectious recombinant virus comprising the protease of the virus infecting the patient. The companies are: Viralliance (France), which produces Phenoscript.TM., Virco (Belgium), which produces Antivirogram.TM., and Virologic (United States), which produces Phenosense.TM.. In the three cases, performing these tests requires significant logistic organisation, personnel skilled in molecular biology and virology, and expensive infrastructures of the P3 secure laboratory type (it would appear that a complete profile would currently cost between 800 and 1,000 euros per sample). The delay existing between the time when the biological material arrives at the laboratories and the time when the resistance profile is established varies, for each strain of HIV-1, between two and three weeks.

Under these circumstances, putting on the market a reliable rapid test that is simple to implement and inexpensive would be advantageous. Such a test would assist the treating doctors to monitor the appearance of resistant strains in patients infected by retroviruses, in particular HIV 1 or 2, in particular for deprived populations. Moreover, this test could also be used for a "high speed" research for new molecules having inhibiting activity for the retrovirus protease.

SUMMARY

This disclosure relates to a method for determining sensitivity or resistance of isolates of HIV (human immunodeficiency virus) retroviruses to chemical molecules having an inhibiting activity on a viral protease or to therapeutic treatments based on inhibitors of the viral protease, including causing cell lysis of at least one yeast by expression of the retrovirus protease.

This disclosure also relates to a method for determining sensitivity or resistance of isolates of HIV (human immunodeficiency virus) retroviruses to chemical molecules having an inhibiting activity on a viral protease or to therapeutic treatments based on inhibitors of the viral protease, including extracting nucleic acids (DNA or RNA) from cells (blood or other) taken from a person or animal infected by the retrovirus; amplifying sequences coding for the protease of the retrovirus to be studied, with or without the or some of the amino acid sequences situated upstream and downstream of the cleavage site of the precursor in which they are situated; recombining the fragments of DNA, the final product of the amplification, and an expression vector allowing the expression of the sequence coding for the protease of the retrovirus to be studied under the control of a known inducible promoter, and co-transformation of the recombined vector with at least one yeast cell whose cell lysis is caused by expression of the retrovirus protease; culturing the co-transformed yeast cell or cells to obtain a sufficient number of transformants to perform the sensitivity or resistance test, and recovery of the transformants issuing from the co-transformed cell, on any suitable medium; incubating the transformants in the presence of an increasing concentration of each viral protease inhibitor to be tested; counting the living cells; and deducing the resistance phenotype.

This disclosure further relates to a diagnostic kit including nucleotide primers including, for a first amplification, primers: sense primer: 5' GAAAGAAGCCCCGCAACTTC3' (SEQ ID NO:2) and antisense primer: 5'GGGATCCATGTCACTTGCCA3' (SEQ ID NO:3) and, for a second amplification, primers: sense primer: 5'CGAGGATCCGGAGACACCATACAGGG AGCCACCAACAGCGGCCGCGCCATGCCTCAATTC3' (SEQ ID NO:4) and antisense primer: 5'GCGGAGCTCGCTTTAGCATTATTTTTATTGGCTCTACTGCGGCCGCTTAAGATT3' (SEQ ID NO:5); at least one expression vector; at least one strain of yeast with an auxotrophy marker to permit selection of a transformant expressing a viral protease; and at least one multi-well plate or any other suitable support.

DETAILED DESCRIPTION

Our methods and kits permit the rapid and low-cost definition of the resistance phenotype of the HIV-2 protease in infected patients, by virtue of the use of yeast.

Our methods can also be implemented to define the resistance phenotype of the HIV-1 protease, or the protease of any other retrovirus.

A scientific article that appeared in 2003 demonstrated that the expression of the HIV-1 protease by the yeast Saccharomyces cerevisiae caused the death of the latter through a still unknown mechanism, the consequence of which was the cell lysis of the yeast in question (Blanco R, Carrasco L and Ventoso I. 2003. Cell killing by HIV-1 protease. J. Biol. Chem. 278:1086-93).

We demonstrated that the same phenomenon occurred when the yeasts expressed the HIV-2 protease. Consequently, by inhibiting the viral enzymatic activity by modification of its catalytic site, we succeeded in preventing the appearance of this cell event.

In addition, Blanco et al (Blanco R, Carrasco L, and Ventoso I. 2003. Cell killing by HIV-1 protease. J. Biol. Chem. 278:1086-93) also showed that the inhibition of the HIV-1 protease by one of the inhibitors used in anti-HIV therapy inhibited the cell death of the yeast caused by the expression of the viral protease. Because of this fact, it is possible to quantitatively measure the sensitivity and resistance of the protease of infected individuals to the various inhibitor molecules.

Our methods, therefore, make it possible to determine in the cellular context of the yeast, the sensitivity phenotype of the viral protease of a retrovirus such as HIV-2, to drugs with an inhibiting activity.

In other words, it is possible to determine the sensitivity or resistance of isolates of retroviruses such as HIV (human immunodeficiency virus) to chemical molecules having an inhibiting activity on the viral protease or to therapeutic treatments based on inhibitors of the viral protease, characterized by the use for this purpose of at least one yeast whose cell lysis is caused by the expression of the retrovirus protease.

The method comprises an expression vector, the choice of the cell system, the method of expressing proteases of infected individuals and the test of susceptibility to drugs.

It comprises the following steps: extracting the nucleic acids (DNA or RNA) from cells (blood or other) taken from the individual or animal infected by the retrovirus, by any suitable means; amplifying the sequences coding for the protease of the retrovirus to be studied; recombining the fragments of DNA, the final product of the amplification, and an expression vector allowing the expression of the sequence coding for the protease of the retrovirus to be studied under the control of a known inducible promoter, and co-transformation of the recombined vector with at least one yeast cell whose cell lysis is caused by the expression of the retrovirus protease; culture of the co-transformed yeast cell or cells to obtain a sufficient number of transformants to perform the sensitivity or resistance test, and recovery of the transformants issuing from the co-transformed cell, on any suitable medium; incubation of the transformants in the presence of an increasing concentration of each viral protease inhibitor to be tested; counting the living cells; and deducing the resistance phenotype.

The sequences coding the therapeutic targets (reverse transcriptase and protease), as well as the so-called "structure proteins" (matrix, capsid, nucleocapsid) and the Integrase enzymatic activity, are situated within a common polypeptide precursor called Gag-Pol, coded by the gag-pol viral gene (Clavel F, Guyader M, Guetard D, Salle M, Montagnier L, Alizon M. 1986. Molecular cloning and polymorphism of the human immune deficiency virus type 2. Nature, 324:691-5). It is the action of the viral protease that, by hydrolysis of specific peptide bonds referred to as cleavage sites, framing the primary sequences of the various constituents of the precursor, is responsible for the release of these proteins (Oroszlan S and Luftig R B. 1990. Retroviral proteinases. Curr Top Microbiol Immunol. 157:153-85. It has been shown that, for the HIV-1 protease, the amino acid sequences are situated upstream and downstream of the cleavage site fulfilling an important role in the recognition event of the enzyme for its substrate, and therefore determinant for its proteolytic activity (Pettit S C, Simsic J, Loeb D D, Everitt L, Hutchison C A 3rd, Swanstrom R. 1991. Analysis of retroviral protease cleavage sites reveals two types of cleavage sites and the structural requirements of the P1 amino acid. J. Biol. Chem. 266:14539-47, Pettit S C, Moody M D, Wehbie R S, Kaplan A H, Nantermet P V, Klein C A, Swanstrom R. 1994. The p2 domain of human immunodeficiency virus type 1 Gag regulates sequential proteolytic processing and is required to produce fully infectious virions. J Virol. 68:8017-27, Moody M D, Pettit S C, Shao W, Everitt L, Loeb D D, Hutchison C A 3rd, Swanstrom R. 1995. A side chain at position 48 of the human immunodeficiency virus type-1 protease flap provides an additional specificity determinant. Virology. 207:475-85, Boross P, Bagossi P, Copeland T D, Oroszlan S, Louis J M, Tozser J. 1999. Effect of substrate residues on the P2' preference of retroviral proteinases. Eur J Biochem. 264:921-9.).

The sequences of the protease amplified by the method include those coding for the isolated protein or those coding for the protein and comprising all or some of the amino acid sequences situated upstream and downstream of the cleavage site of the protein precursor in which they are situated.

The protocols used in the laboratory to obtain yeast transformants coding for an exogenous gene generally begin with a first step for obtaining fragments of DNA coding for the gene of interest, gene amplification (PCR technique) or release of the gene by virtue of the action of the restriction enzymes which cut DNAs containing the sequence of interest. This first step can be equivalent in time to half a day's work.

The DNA fragment released is then sub-cloned in an expression vector by the action of the DNA Ligase enzyme (an operation lasting one night) and the product of the reaction is amplified in a bacterium, after its transformation (one day to obtain bacteria having incorporated plasmid DNA, and one and a half days of obtaining and characterising the transformant sought, containing the plasmid coding for the gene of interest).

Moreover, to produce sufficient quantities of the plasmid containing the gene of interest with a view to transformation of the yeast, the bacterial clone obtained in the previous step was amplified (one night) and the plasmids were purified by conventional known methods (one day).

The purified plasmid obtained is then used to transform the selected yeast strain (1/2 day).

The transformed yeast strain is obtained approximately 4 days after the transformation event.

Consequently, by using conventional protocols making it possible to obtain a sufficient quantity of yeast transformants for a subsequent study of a gene of interest, for example for developing a sensitivity or resistance test, the time that elapses between the preparation of the DNA fragment coding for the gene of interest and the obtaining of the yeast strain expressing it is a minimum of 8 days. Moreover, as disclosed above, several techniques must be used.

The magnitude of these delays and the multiplicity of the techniques used necessarily give rise to high production costs, incompatible with the development of a rapid sensitivity or resistance test that is simple to implement and inexpensive.

We therefore developed of an innovative technology allowing easy management of a large number of samples, for the purpose in particular of testing, rapidly, effectively and at less cost, a large quantity of proteases issuing from different patients under treatment.

Considering the studies on the ability of yeast to repair "broken DNA" (nicked DNA) by the homologous recombination mechanism, it was found that, during this cell event, a DNA molecule is repaired at a precise point in its sequence, by putting in place homologous sequences at the "nicking" site and taken within another DNA molecule. By using this physiological phenomenon, it is possible to introduce a defined sequence within the "nicked" DNA provided that the defined sequence is framed on each side by sequences identical to those situated around the "nicking" site.

The minimum size of the homologous sequences that have to be present in the two DNA molecules for the recombination event to be able to take place is approximately 40 pairs of bases.

This technique very advantageously simplifies obtaining the transformants by reducing in particular the number of manipulations which involve a significant reduction in the experimentation time necessary (approximately half compared with the known protocols) and in the production cost. Use of this technique also enables a large number of samples to be manipulated at the same time.
 

Claim 1 of 8 Claims

1. A method for determining if an HIV-2 retrovirus is sensitive, or resistant, to an HIV-2 viral protease inhibitor comprising: a) extracting nucleic acids from cells taken from a human infected by a HIV-2 retrovirus; b) amplifying from the extracted nucleic acids a nucleic acid sequence comprising the sequence encoding the amino acid sequence of HIV-2 protease; c) combining the amplified sequence and an expression vector allowing the expression of the sequence coding of the HIV-2 protease under the control of an inducible promoter by transforming a yeast cell with said sequence and expression vector; d) culturing the transformed yeast cell under conditions that do not result in HIV-2 protease expression to obtain a population; e) inducing the expression of the HIV-2 protease by inducing the promoter of the expression vector; f) incubating the population with the HIV-2 viral protease inhibitor; g) monitoring growth of the population; h) determining if the population grew or stopped growing; whereby the HIV-2 retrovirus is determined to be sensitive to the HIV-2 viral protease inhibitor if the population grew after incubation with said HIV-2 viral protease inhibitor, or the HIV-2 isolate is determined to be resistant to the HIV-2 viral protease inhibitor if the population stopped growing after incubation with said HIV-2 viral protease inhibitor.
 

____________________________________________
If you want to learn more about this patent, please go directly to the U.S. Patent and Trademark Office Web site to access the full patent.
 

 

     
[ Outsourcing Guide ] [ Cont. Education ] [ Software/Reports ] [ Training Courses ]
[ Web Seminars ] [ Jobs ] [ Consultants ] [ Buyer's Guide ] [ Advertiser Info ]

[ Home ] [ Pharm Patents / Licensing ] [ Pharm News ] [ Federal Register ]
[ Pharm Stocks ] [ FDA Links ] [ FDA Warning Letters ] [ FDA Doc/cGMP ]
[ Pharm/Biotech Events ] [ Newsletter Subscription ] [ Web Links ] [ Suggestions ]
[ Site Map ]